ID: 1006716440

View in Genome Browser
Species Human (GRCh38)
Location 6:36123674-36123696
Sequence CTCTGGACAATGACTCTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006716440_1006716446 -1 Left 1006716440 6:36123674-36123696 CCTTACAGAGTCATTGTCCAGAG No data
Right 1006716446 6:36123696-36123718 GGTGGAGAGGGACATGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006716440 Original CRISPR CTCTGGACAATGACTCTGTA AGG (reversed) Intergenic
No off target data available for this crispr