ID: 1006717179

View in Genome Browser
Species Human (GRCh38)
Location 6:36128095-36128117
Sequence CCATGAGAGCCTAAGGAACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 110}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006717179_1006717190 -1 Left 1006717179 6:36128095-36128117 CCCCGTTCCTTAGGCTCTCATGG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1006717190 6:36128117-36128139 GGGTCTCAGGGCCAGAGTAGGGG 0: 1
1: 0
2: 5
3: 29
4: 282
1006717179_1006717196 9 Left 1006717179 6:36128095-36128117 CCCCGTTCCTTAGGCTCTCATGG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1006717196 6:36128127-36128149 GCCAGAGTAGGGGGTGGGGGAGG 0: 1
1: 0
2: 17
3: 186
4: 1337
1006717179_1006717193 4 Left 1006717179 6:36128095-36128117 CCCCGTTCCTTAGGCTCTCATGG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1006717193 6:36128122-36128144 TCAGGGCCAGAGTAGGGGGTGGG 0: 1
1: 0
2: 7
3: 37
4: 431
1006717179_1006717188 -3 Left 1006717179 6:36128095-36128117 CCCCGTTCCTTAGGCTCTCATGG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1006717188 6:36128115-36128137 TGGGGTCTCAGGGCCAGAGTAGG 0: 1
1: 0
2: 4
3: 41
4: 366
1006717179_1006717201 21 Left 1006717179 6:36128095-36128117 CCCCGTTCCTTAGGCTCTCATGG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1006717201 6:36128139-36128161 GGTGGGGGAGGGAAAAGGCTGGG No data
1006717179_1006717189 -2 Left 1006717179 6:36128095-36128117 CCCCGTTCCTTAGGCTCTCATGG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1006717189 6:36128116-36128138 GGGGTCTCAGGGCCAGAGTAGGG 0: 1
1: 0
2: 4
3: 27
4: 275
1006717179_1006717194 5 Left 1006717179 6:36128095-36128117 CCCCGTTCCTTAGGCTCTCATGG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1006717194 6:36128123-36128145 CAGGGCCAGAGTAGGGGGTGGGG No data
1006717179_1006717195 6 Left 1006717179 6:36128095-36128117 CCCCGTTCCTTAGGCTCTCATGG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1006717195 6:36128124-36128146 AGGGCCAGAGTAGGGGGTGGGGG 0: 1
1: 0
2: 9
3: 114
4: 796
1006717179_1006717198 10 Left 1006717179 6:36128095-36128117 CCCCGTTCCTTAGGCTCTCATGG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1006717198 6:36128128-36128150 CCAGAGTAGGGGGTGGGGGAGGG No data
1006717179_1006717191 0 Left 1006717179 6:36128095-36128117 CCCCGTTCCTTAGGCTCTCATGG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1006717191 6:36128118-36128140 GGTCTCAGGGCCAGAGTAGGGGG No data
1006717179_1006717199 16 Left 1006717179 6:36128095-36128117 CCCCGTTCCTTAGGCTCTCATGG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1006717199 6:36128134-36128156 TAGGGGGTGGGGGAGGGAAAAGG No data
1006717179_1006717192 3 Left 1006717179 6:36128095-36128117 CCCCGTTCCTTAGGCTCTCATGG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1006717192 6:36128121-36128143 CTCAGGGCCAGAGTAGGGGGTGG No data
1006717179_1006717200 20 Left 1006717179 6:36128095-36128117 CCCCGTTCCTTAGGCTCTCATGG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1006717200 6:36128138-36128160 GGGTGGGGGAGGGAAAAGGCTGG No data
1006717179_1006717202 22 Left 1006717179 6:36128095-36128117 CCCCGTTCCTTAGGCTCTCATGG 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1006717202 6:36128140-36128162 GTGGGGGAGGGAAAAGGCTGGGG 0: 1
1: 1
2: 6
3: 91
4: 911

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006717179 Original CRISPR CCATGAGAGCCTAAGGAACG GGG (reversed) Intronic
903296469 1:22346395-22346417 CCATGGGAGCAGAAGGGACGGGG + Intergenic
907875814 1:58486885-58486907 CAAGGAAAGCCTAAGGAAAGGGG + Intronic
913177971 1:116292315-116292337 CCAGGAAAGCCTAAGGGAAGAGG - Intergenic
915121560 1:153632663-153632685 CCATGTGAGGGTAAGGATCGTGG - Intronic
919953343 1:202387415-202387437 CCCTGAAAGCCTAAGGAGTGAGG + Intronic
922327119 1:224538327-224538349 CCATAAGAGTCTCAGGAATGTGG + Intronic
923155539 1:231275518-231275540 CCATGAGTGCTCAAGGAACAAGG + Intronic
923304829 1:232678859-232678881 CCATGAAAGCCTAGGGAAGAAGG + Intergenic
1063111243 10:3039261-3039283 AAATGAGAGCCTAACGAAAGGGG - Intergenic
1066642505 10:37570623-37570645 CCATGAGAACCTCTGGAAAGAGG - Intergenic
1067732091 10:48819847-48819869 ACATGAGAGAATAACGAACGTGG - Intronic
1067960177 10:50839345-50839367 CCATGAAAGACCAAGGAATGGGG + Intronic
1069476137 10:68734407-68734429 CTTTGGGAGCCTAAGGAAGGAGG + Intronic
1070360426 10:75683239-75683261 CCATGAGAGCCTAGGAAATTTGG - Intronic
1070704186 10:78625588-78625610 CCATGAAAGCCGAAGGAGCTGGG + Intergenic
1070792448 10:79197328-79197350 CCATCAGAGCCAAAGGACCCTGG - Intronic
1071158515 10:82719492-82719514 TCAAGAGAGCCTAAGAAATGTGG - Intronic
1072848701 10:98862213-98862235 GCATGAGAGCCTAAGAAAAAAGG + Intronic
1072947948 10:99827277-99827299 CCATCAGAGTCTAAGCCACGAGG - Intronic
1075934436 10:126327358-126327380 CCATGGGAACCTAAAGAAAGGGG - Intronic
1076252813 10:128997058-128997080 CCCTGAGTCCCTAAGGAAGGGGG - Intergenic
1077424188 11:2466767-2466789 CCAAGGGAGGCTAAGGAACATGG - Intronic
1077649420 11:3956712-3956734 CTATGAGAGGCTAAGGCAGGAGG + Intronic
1077937600 11:6804795-6804817 CCTTGAGAGACTGAGGAAGGAGG + Intergenic
1082883010 11:58056951-58056973 CCATGGAAGCCTTAGGAAAGTGG - Intronic
1086630974 11:89019449-89019471 CTTTGAGAGCCTAAGGCAGGTGG + Intronic
1090236744 11:125153923-125153945 CCATGAGAGCCTCAAGAGCAGGG + Intergenic
1092873335 12:12826691-12826713 CTATGAGAGGCTAAGGCAGGTGG - Intronic
1093058694 12:14580391-14580413 CTATGGGAGCCTAAGGCAGGTGG - Intergenic
1097575542 12:61388650-61388672 CAATGAGAGCCTAGTGAAGGGGG + Intergenic
1097937772 12:65272786-65272808 CCCTGAGAGGCCAAGGAACGAGG - Intergenic
1099036052 12:77589039-77589061 CCATCAAAGCCAAAGCAACGTGG + Intergenic
1100517709 12:95344222-95344244 CCATGTCAGACTAAGGAACTTGG + Intergenic
1102622648 12:114209021-114209043 ACATGAGAGCTTGAGGAACTGGG - Intergenic
1104934534 12:132357489-132357511 CCATGGGAACCAAATGAACGGGG + Intergenic
1105474027 13:20715854-20715876 CCATCTCAGCCTAAGGAACTAGG + Intronic
1106997654 13:35506310-35506332 CTATGAGAGGCCAAGGCACGAGG - Intronic
1113748742 13:112764379-112764401 CCATGAAATCGTAAGGAACAGGG - Intronic
1114763658 14:25346266-25346288 ACATGAGAGCCCAAGGCAGGAGG + Intergenic
1115020930 14:28681223-28681245 ACTTGAGAGGCTAAGGAAGGAGG - Intergenic
1117309046 14:54503928-54503950 CCATGAGAGTTTCAGGAACTTGG + Intergenic
1118468900 14:66056773-66056795 CCATGAGAGCCAGAGGACCCCGG - Intergenic
1119408522 14:74413242-74413264 CCATCAGAGCCCAAGGGAGGAGG - Intronic
1124584583 15:30992671-30992693 ACTTGAGAGGCTAAGGCACGTGG - Intergenic
1127436815 15:58966114-58966136 CTTTGAGAGGCTGAGGAACGCGG + Intronic
1129584743 15:76850615-76850637 CTTTGAGAGGCTAAGGAAGGAGG + Intronic
1131690019 15:94816697-94816719 CTTTGAGAGCCTAAGGCAGGAGG + Intergenic
1133611789 16:7440481-7440503 CACTGAGAGCCCAAGGAATGTGG + Intronic
1136028107 16:27482936-27482958 CCCTGCCAGCCTTAGGAACGTGG - Intronic
1136315851 16:29454460-29454482 CAATCAGAGCCTGAGGAAGGTGG + Exonic
1136430428 16:30193802-30193824 CAATCAGAGCCTGAGGAAGGTGG + Exonic
1138447992 16:57076855-57076877 CCCTGAGAGCCTCAGAAAGGTGG - Exonic
1141425483 16:83942009-83942031 CCTTGAGAGGCTAAGGCAGGTGG - Intronic
1141914160 16:87082537-87082559 CCCTGAGAGCCATAGGAACAAGG - Intergenic
1142708035 17:1708888-1708910 CCATGTGAGCCTAAGGAGTTTGG - Intronic
1143733710 17:8895944-8895966 CCAAGAGAGGCCAAGGAAGGGGG - Intronic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1145775022 17:27521675-27521697 CTTTGAGAGCCTAAGGCAGGTGG - Intronic
1151241478 17:72761629-72761651 CCCTGAGAGGCTAAGCAACCTGG + Intronic
1151873752 17:76854268-76854290 ACTTGAGAGGCTAAGGAAGGAGG + Intergenic
1151887466 17:76931721-76931743 CCAAGAGAGCCACAGGAATGAGG + Intronic
1155360296 18:24992931-24992953 ACTTGAGAGCCCAAGGAACCTGG + Intergenic
1157156884 18:45277038-45277060 CCATGACAGGCTAAGGAAAATGG - Intronic
1159887861 18:73926742-73926764 CCGTGAGAGTCTAAGGCAGGTGG - Intergenic
1166287072 19:41837760-41837782 CCATGAGAGACTTAGGCACCAGG + Intronic
1167441403 19:49511385-49511407 CCTTGAGAGGCTAAGGCAGGTGG + Intronic
1168016952 19:53581565-53581587 GCAGGAGAGCCTTAGGCACGGGG + Intergenic
925650942 2:6088492-6088514 CCATGACAGCCTCTGGAAGGAGG - Intergenic
926419624 2:12684011-12684033 CCATGAGATGCTAATGAAGGAGG + Intergenic
926692487 2:15747259-15747281 CCACGAGAGCCTGAGGGAAGAGG + Intergenic
944486874 2:200216149-200216171 CCATAAGAGCCCATGGAAGGAGG - Intergenic
945609698 2:211984500-211984522 ACATGACAGCCTAAGGTACAGGG - Intronic
946041240 2:216784476-216784498 GCATGAGAGGCAAAGGAACTGGG + Intergenic
1169611061 20:7380582-7380604 CCATGTGAGACACAGGAACGAGG + Intergenic
1173626207 20:44475065-44475087 CCATGAGGGCCACAAGAACGTGG - Intergenic
1177190712 21:17848106-17848128 CAATGAGGGACTAAGGAAGGGGG - Intergenic
1178940288 21:36899858-36899880 CTTTGAGAGGCTAAGGAAGGCGG + Intronic
1184373079 22:44095035-44095057 CCGTGAGAGCCCAAGGAAAGAGG + Intronic
1184416467 22:44354601-44354623 CCATTAAAGCCTAAGGAAGAAGG + Intergenic
955513688 3:59706465-59706487 CCATGAAATCCTAAGGATCCGGG + Intergenic
955772725 3:62402210-62402232 CCAAAAGAGACTAAGAAACGGGG + Intronic
959850472 3:111081030-111081052 CCCTGAGAGGCTAAGGCAGGAGG + Intronic
972289407 4:37677725-37677747 CTATGAGAGCCCAAGGCAGGTGG + Intronic
975102789 4:70533720-70533742 CCTTGAGAGCCTGAGGCAAGAGG + Intergenic
975745902 4:77473561-77473583 CCATAAGAACCCAGGGAACGTGG + Intergenic
982544329 4:156714030-156714052 CCATGAGAGGCTGAGGAAGGAGG + Intergenic
991124098 5:63050225-63050247 CAGTGAGAGCATAAGGAAGGAGG - Intergenic
997564534 5:134876798-134876820 CCCTGAGAGACTAAGCAACCTGG + Intronic
1003245692 6:4380175-4380197 CCAGGAGAGCCGCAGGAACCAGG - Intergenic
1003791122 6:9549049-9549071 CCATGAAATCCTCAGGAACAGGG + Intergenic
1005335801 6:24794884-24794906 CCATGAGAGGCTGAGGCAGGAGG + Intergenic
1006717179 6:36128095-36128117 CCATGAGAGCCTAAGGAACGGGG - Intronic
1013802167 6:113959670-113959692 CCATGAAAGCCTAGGGTAGGGGG + Intronic
1016472978 6:144394343-144394365 GAATGAGAGCCAAAGGAAAGGGG + Intronic
1018698404 6:166408102-166408124 CCCTGAGAGCCTCTGGAAGGAGG + Intergenic
1023195589 7:37635499-37635521 CCATGTGAGCATCAGGAATGAGG - Intergenic
1028254691 7:88579392-88579414 ACTTGAGAGGCTAAGGCACGAGG + Intergenic
1029894158 7:103964048-103964070 ACATGAGAGGCTAAGGCAGGAGG + Intronic
1030097864 7:105917107-105917129 CCATGAAAGCCCAAGGATCCAGG + Intronic
1037590365 8:20306809-20306831 GCATGAAAGCCTCAGGAATGTGG + Intergenic
1038076834 8:24085345-24085367 ACATGAGAGACTGAGGAAGGAGG - Intergenic
1039736927 8:40343107-40343129 CCGTGAGAGCCCAGGGAACTGGG - Intergenic
1040913353 8:52543425-52543447 CCATGAGCTCCTGAGGGACGTGG + Intronic
1043515525 8:80991478-80991500 CCATGAGAACCTGATGAACGTGG - Exonic
1048558793 8:135510204-135510226 CTTTGAGAGGCTAAGGAAAGAGG - Intronic
1049749078 8:144275077-144275099 CCAAGAGAGCCGAAGGATGGGGG + Intronic
1050514767 9:6431362-6431384 CTATGAGAGACCAAGGAAAGAGG + Intronic
1053085904 9:35221311-35221333 CTATGAGAGGCCAAGGAAGGTGG - Intronic
1057909238 9:99005138-99005160 CCATGGGAGCCTGAGGCACGGGG + Intronic
1058328906 9:103734236-103734258 CCAGGAAAGCCTAAGAAACAAGG - Intergenic
1061246096 9:129401887-129401909 CCAAGAGAACCTCAGGAACAGGG - Intergenic
1061588522 9:131583679-131583701 TCATGAGAGCCTCAGGAGCCTGG - Intronic
1185466024 X:354605-354627 CCATGAGAGGCTGAGGCAAGAGG + Intronic
1194863189 X:99030359-99030381 CCATGAGATCCTAAAGAAGCAGG + Intergenic
1197761158 X:130029336-130029358 CCATGAGAAGCTAAAGAACTGGG - Intronic
1199070271 X:143468207-143468229 GAATGAGAGCCAAAGGAAGGGGG + Intergenic