ID: 1006719154

View in Genome Browser
Species Human (GRCh38)
Location 6:36138872-36138894
Sequence TCCAGCAGGTCCGCAGCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 446}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006719154_1006719157 0 Left 1006719154 6:36138872-36138894 CCTGCAGCTGCGGACCTGCTGGA 0: 1
1: 0
2: 0
3: 28
4: 446
Right 1006719157 6:36138895-36138917 GAAGATGCTGGAGCTAGACGTGG 0: 1
1: 0
2: 1
3: 12
4: 164
1006719154_1006719158 15 Left 1006719154 6:36138872-36138894 CCTGCAGCTGCGGACCTGCTGGA 0: 1
1: 0
2: 0
3: 28
4: 446
Right 1006719158 6:36138910-36138932 AGACGTGGACAAGCGCCTGACGG 0: 1
1: 0
2: 0
3: 4
4: 58
1006719154_1006719159 24 Left 1006719154 6:36138872-36138894 CCTGCAGCTGCGGACCTGCTGGA 0: 1
1: 0
2: 0
3: 28
4: 446
Right 1006719159 6:36138919-36138941 CAAGCGCCTGACGGCCGCGCAGG 0: 1
1: 0
2: 0
3: 0
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006719154 Original CRISPR TCCAGCAGGTCCGCAGCTGC AGG (reversed) Exonic
900306967 1:2015200-2015222 TGCTGCAGCTCCGCAGCAGCAGG - Intergenic
900538504 1:3190958-3190980 CCCAGCAGGCCCCAAGCTGCAGG - Intronic
900702710 1:4058205-4058227 TCCAGCAAGTCCGAGGCTCCAGG + Intergenic
901654111 1:10759590-10759612 TCAGGCAGGTCTGCAGCTTCAGG + Intronic
901814663 1:11787380-11787402 TCCTTCAGACCCGCAGCTGCTGG + Exonic
901833233 1:11906854-11906876 TCCAGCAGTTCAGCTGCTACAGG + Intergenic
902451725 1:16500632-16500654 GCCAGCAGGCCCGCGGCTGATGG + Intergenic
903968249 1:27102823-27102845 CCCAGCAGGGCTGCAGCTACGGG - Intronic
905455618 1:38086050-38086072 TCCAGAAGGTCAGGAGCAGCTGG - Intergenic
906551218 1:46668050-46668072 TCCAGCTGCTGCGCAGGTGCGGG - Exonic
908913651 1:69101756-69101778 TCCAGCAGACCTGCAGCTGAGGG - Intergenic
909422029 1:75477169-75477191 TCCAACAGGCCTGCAGCTGAGGG + Intronic
910295708 1:85642764-85642786 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
910618754 1:89230022-89230044 TCCAACAGATCTGCAGCTGAGGG - Intergenic
911541253 1:99161471-99161493 TCCAGCAGATCTGCAGCAGAGGG - Intergenic
912110082 1:106330305-106330327 TCCAACAGATCTGCAGCTGAGGG + Intergenic
913600993 1:120421029-120421051 TCCAGAAGCTGCCCAGCTGCAGG - Intergenic
914086062 1:144455604-144455626 TCCAGAAGCTTCCCAGCTGCAGG + Intronic
914191954 1:145419555-145419577 TCCAGAAGCTGCCCAGCTGCAGG + Intergenic
914589861 1:149097505-149097527 TCCAGAAGCTGCCCAGCTGCAGG + Intronic
915519913 1:156436146-156436168 TCCGGCGGGTGCGCAGCGGCCGG + Intergenic
915711442 1:157902720-157902742 TCCAACAGATCTGCAGCTGAGGG + Intergenic
915992160 1:160529206-160529228 TCCAGCAGGCCTGCAGCAGAGGG - Intergenic
917207822 1:172596512-172596534 TCCAGCAGACCTGCAGCTGAGGG - Intronic
917737242 1:177932521-177932543 TCCAGCGGGGGAGCAGCTGCGGG - Exonic
917827482 1:178838439-178838461 TCCAACAGACCTGCAGCTGCGGG + Intronic
917915329 1:179695226-179695248 TCCAGCAGATCTGCAGCAGAGGG + Intergenic
918089521 1:181276761-181276783 TCCAACAGATCTGCAGCTGAGGG + Intergenic
919063847 1:192668193-192668215 TCCAGCAGACCTGCAGCTGAGGG - Intergenic
920253419 1:204637955-204637977 TCCCCCAGCTCCGCAGCTCCTGG - Intronic
920390152 1:205594949-205594971 TGCAACTGGTCCGGAGCTGCTGG + Intronic
921038596 1:211407511-211407533 TCCAACAGATCTGCAGCTGAGGG - Intergenic
921258070 1:213360784-213360806 TCCAACAGATCTGCAGCTGAGGG - Intergenic
921846403 1:219887608-219887630 TCCAACAGATCTGCAGCTGAGGG + Intronic
922188153 1:223294404-223294426 TGCAGAAGTTCCTCAGCTGCAGG + Intronic
922848242 1:228707573-228707595 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
922917579 1:229271176-229271198 TCCGGCTGGGCCGCAGCCGCTGG + Exonic
923019933 1:230155338-230155360 TCCCGGAGGTCAGCGGCTGCAGG - Intronic
924754108 1:246926159-246926181 ACCAGAAGGTAGGCAGCTGCTGG + Intronic
924948064 1:248858977-248858999 GCGAGCAGGCCCGGAGCTGCTGG + Intronic
1062761762 10:28005-28027 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
1065049754 10:21779510-21779532 TCCAGCAGATGTGCAGCTGAGGG + Intronic
1065500212 10:26373611-26373633 CACAGCTGGTCCGCAGCTGGTGG + Intergenic
1065649888 10:27876460-27876482 TCCAGCAGACCTGCAGCTGAGGG + Intronic
1066751340 10:38660063-38660085 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1066965702 10:42263028-42263050 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1067335529 10:45359634-45359656 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
1068413274 10:56684719-56684741 TCCAACAGGCCTGCAGCTGAGGG + Intergenic
1069256255 10:66335456-66335478 TCCAACAGATCTGCAGCTGAGGG - Intronic
1069375476 10:67788604-67788626 ACCAGCAGGTACTCAGCAGCAGG + Intergenic
1069808792 10:71143284-71143306 TCCAGCAAGCCCCCAGCAGCAGG - Intergenic
1070748105 10:78947316-78947338 TCCTGCAGGGCAGCGGCTGCTGG - Intergenic
1071244333 10:83746431-83746453 TCCAGCAGACCTGCAGCTGAAGG - Intergenic
1071532353 10:86400197-86400219 TCCCGCAGGGCCGCAGCCGCGGG - Intergenic
1072516154 10:96185563-96185585 TCCAGCAGACCAGCAGCTGAGGG - Intronic
1072869295 10:99099907-99099929 TCCAGCAGAACTGCAGCTGAGGG + Intronic
1072901670 10:99412861-99412883 TCCAACAGATCTGCAGCTGAGGG + Intronic
1073052938 10:100681020-100681042 TCCAGCGGGTCCGGTGCAGCCGG + Intergenic
1074043666 10:109817657-109817679 TCCAGCAGACCTGCAGCTGAGGG - Intergenic
1074251605 10:111756372-111756394 TCCCCCAGCTCCACAGCTGCTGG - Intergenic
1074303276 10:112251813-112251835 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1076159115 10:128228832-128228854 TCCAGCAGACCTGCAGCTGAGGG - Intergenic
1076424883 10:130360876-130360898 TCCTGCTGGGCAGCAGCTGCGGG - Intergenic
1076583890 10:131532463-131532485 GCCCGCAGGTGCGCAGCTGCAGG + Intergenic
1076747276 10:132520593-132520615 GCCAGCAGGTCCTGAGCAGCCGG - Intergenic
1076752303 10:132549667-132549689 TCCTGGAGCTCTGCAGCTGCAGG + Intronic
1077092143 11:783627-783649 TCCCGCAGGTGCTCAGCTACTGG - Exonic
1077142465 11:1030589-1030611 GCCAGCCGGTCCGCCGCTGGCGG - Exonic
1078096041 11:8297977-8297999 TCCACCTGGTCCCCAGCTGAGGG + Intergenic
1078951778 11:16142267-16142289 TCCAACAGATCTGCAGCTGAGGG + Intronic
1079174641 11:18127997-18128019 TCCAACAGATCTGCAGCTGAGGG - Intronic
1080081300 11:28221779-28221801 TCCAGCAGATGTGCAGCTGAGGG - Intronic
1082227561 11:49726064-49726086 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1082574524 11:54786771-54786793 TCCAACAGGCCTGCAGCTGAGGG - Intergenic
1082880146 11:58029228-58029250 TCCGGCTGGTACGCTGCTGCTGG + Intronic
1083065683 11:59921728-59921750 TCCATCAGGTGGGCAGCTTCTGG + Intergenic
1083172925 11:60933702-60933724 TCGAGCAGGTCCGCGGCTGGAGG + Exonic
1083780731 11:64916066-64916088 TCCACCAGGTCCAGAGCAGCAGG - Intronic
1084489964 11:69472859-69472881 TCCAGCTGGTCTTCAGCAGCTGG + Intergenic
1085441432 11:76567112-76567134 TCCTGCAGTCCCACAGCTGCTGG - Intergenic
1088293038 11:108261398-108261420 TCCAACAGGCCTGCAGCTGAGGG + Intronic
1088294366 11:108276618-108276640 TCCAGCAGATCTGCAGCAGAGGG - Intronic
1088309183 11:108441736-108441758 TCCAACAGACCTGCAGCTGCGGG + Intronic
1088481084 11:110296746-110296768 TCCCGCAGGCTCGCAGCCGCAGG + Intergenic
1088850104 11:113697299-113697321 TCCAGCAGATCTGCAGCCCCAGG + Exonic
1089061513 11:115629762-115629784 TCCAGCAGGGCCAGAGCTACGGG - Intergenic
1089192929 11:116667636-116667658 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1089448404 11:118572450-118572472 GGCAGCAGGTCCAGAGCTGCTGG + Exonic
1089888571 11:121855800-121855822 TCCAACAGGCCTGCAGCTGAGGG + Intergenic
1090075831 11:123579520-123579542 TCCAGCGGCTCGGCAGGTGCAGG + Intronic
1090765618 11:129873783-129873805 GCCAGCAGGACCGCAGATCCGGG - Exonic
1091421394 12:343649-343671 TCCAACAGATCTGCAGCTGAGGG + Intronic
1091824808 12:3504428-3504450 TCCAGCAGACCTGCAGCTGAGGG - Intronic
1092314040 12:7391102-7391124 TCCAACAGGCCTGCAGCTGAGGG + Intronic
1092560845 12:9611220-9611242 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
1092661850 12:10747484-10747506 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1093610633 12:21150579-21150601 TCCAGCAGACCTGCAGCTGAGGG + Intronic
1093673037 12:21900224-21900246 TCCAGCAGACCTGCAGCTGAGGG + Intronic
1093714601 12:22366814-22366836 TCCAGCAGACCTGCAGCTGAGGG + Intronic
1093998213 12:25665684-25665706 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1094311906 12:29093240-29093262 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1094811510 12:34142946-34142968 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
1095209323 12:39474877-39474899 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1095228017 12:39699858-39699880 GCCAACAGATCCGCAGCTGAGGG + Intronic
1096512855 12:52141297-52141319 TTCAGCAGGACCCCTGCTGCAGG - Intergenic
1097018576 12:56004413-56004435 GCCAGCAGGACCTCAGCTTCAGG - Exonic
1097304939 12:58058896-58058918 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1097341579 12:58444285-58444307 TCCACCAAATCCCCAGCTGCTGG - Intergenic
1099240056 12:80128266-80128288 TCCAGCAGACCTGCAGCTGAGGG - Intergenic
1099697380 12:86039980-86040002 TCCAGCAGATCTGCAGCAGAAGG - Intronic
1100248538 12:92790019-92790041 TCCAACAGATCTGCAGCTGAGGG + Intronic
1100900878 12:99238799-99238821 TCCAGCAGACCTGCAGCTGAGGG + Intronic
1101243000 12:102856748-102856770 TCCAACAGATCTGCAGCTGAGGG + Intronic
1101483489 12:105127195-105127217 TCTAGCAGTTTGGCAGCTGCTGG - Exonic
1102035396 12:109768266-109768288 TCCAGCACGGCCGCACCAGCTGG + Exonic
1105648493 13:22346983-22347005 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
1106220826 13:27744987-27745009 TCCAGCAGTTTTTCAGCTGCCGG + Intergenic
1107486235 13:40829596-40829618 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
1108561997 13:51653632-51653654 TCCAACAGACCCGCAGCTGAGGG - Intronic
1109806718 13:67453172-67453194 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1110086742 13:71389787-71389809 TCCAGCAGACCTGCAGCTGAGGG - Intergenic
1110824001 13:79951205-79951227 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1110942124 13:81363427-81363449 TCCAGCAGATCTGCAGCAGAGGG + Intergenic
1111322655 13:86650834-86650856 TCCAGCAGACCTGCAGCTGAGGG - Intergenic
1111597190 13:90427510-90427532 TCCAGCACAGCTGCAGCTGCTGG + Intergenic
1111765087 13:92517596-92517618 TCCAGCAGACCTGCAGCTGAGGG + Intronic
1113540108 13:111100627-111100649 TCCAACAGAGCCACAGCTGCAGG + Intergenic
1114618541 14:24081490-24081512 GCCCGCAGCCCCGCAGCTGCCGG + Exonic
1115624790 14:35179960-35179982 TCCAGCAGACCTGCAGCTGAGGG - Intronic
1116711267 14:48371482-48371504 TCCAGCAGACCTGCAGCTGAGGG - Intergenic
1116792817 14:49357459-49357481 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1116801956 14:49452729-49452751 TGCAGCAGTTCCGAAGCTGCTGG - Intergenic
1117511454 14:56455350-56455372 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
1117635715 14:57740995-57741017 TCCAACAGATCTGCAGCTGAGGG + Intronic
1117900552 14:60528512-60528534 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1118648920 14:67868851-67868873 TCCAGCAGACCTGCAGCTGAGGG + Intronic
1121880837 14:97499081-97499103 TCCAGCAGGTCCCCTGCACCTGG - Intergenic
1123492115 15:20789128-20789150 TCCAGCAGGCCCTCAGCAGATGG - Intergenic
1123548619 15:21358218-21358240 TCCAGCAGGCCCTCAGCAGATGG - Intergenic
1124028948 15:25991621-25991643 TGCAGCTGGTCCCAAGCTGCAGG - Intergenic
1124666821 15:31599392-31599414 TCCAGCAGGCCTGCAGCAGAGGG + Intronic
1126086970 15:45020334-45020356 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1126255019 15:46615210-46615232 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
1126554185 15:49967004-49967026 TCCAGCAGACCTGCAGCTGAGGG + Intronic
1126849769 15:52789799-52789821 CCCAGCAGGTCGGCAGGGGCGGG + Exonic
1129219884 15:74125947-74125969 TCCACCAAGTCTGCAGTTGCGGG + Intronic
1129944232 15:79525013-79525035 CCCAGGAGGTCCCCACCTGCAGG - Intergenic
1130305779 15:82711332-82711354 GCCAGCAGGAGCGCAGCAGCGGG + Intergenic
1130364550 15:83222431-83222453 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
1130533667 15:84767372-84767394 CCCAGCAGGTCTGAGGCTGCTGG + Intronic
1132241087 15:100257442-100257464 TCCAGCAGCTCCACAGCAGCAGG + Intronic
1202956953 15_KI270727v1_random:85449-85471 TCCAGCAGGCCCTCAGCAGATGG - Intergenic
1132640200 16:974697-974719 TGAAGCCGGCCCGCAGCTGCTGG - Intronic
1136731388 16:32417043-32417065 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1136899509 16:34019574-34019596 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1136908820 16:34129358-34129380 TCCAGCAGACCTGCAGCTGAGGG - Intergenic
1136927671 16:34389229-34389251 TGCAGCAGATCCGCAGCCCCGGG - Intergenic
1136976903 16:35022577-35022599 TGCAGCAGATCCGCAGCCCCGGG + Exonic
1137254313 16:46762474-46762496 TCCCGCAGGACCCCAGCTGACGG + Intronic
1139813680 16:69647264-69647286 TCCAGCAAGTCCTCAGGTGGTGG - Exonic
1140147498 16:72325265-72325287 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1141210837 16:81978133-81978155 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG + Intergenic
1141565045 16:84895782-84895804 TCCAGCAGGTGCTCAGTAGCCGG - Intronic
1142134865 16:88447153-88447175 ACCAGCAGGTCAGCAGGGGCAGG + Intergenic
1202995004 16_KI270728v1_random:100228-100250 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1203021691 16_KI270728v1_random:412570-412592 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1143452844 17:7046378-7046400 GCCAGCAGGTCCTCAGCTACCGG + Intergenic
1145220576 17:21085225-21085247 CCCAGCAGGTCTGCCGTTGCTGG + Intergenic
1145861299 17:28212446-28212468 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1146298446 17:31670149-31670171 TCCAACAGGCCTGCAGCTGAGGG - Intergenic
1148122862 17:45222666-45222688 TCCAGCAGGTCTCCCGCTCCCGG - Intronic
1148950399 17:51305828-51305850 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
1150007090 17:61476664-61476686 GGCAGCAGGTCCCCAGCTGCAGG + Intronic
1151543334 17:74776524-74776546 TCCCGCCGGTCCGCTGCTGCCGG - Exonic
1151569613 17:74919729-74919751 GCCTGCAGGACCGCAGCTGTGGG - Exonic
1152475744 17:80516891-80516913 TCCAGCCAGTCCACAACTGCCGG - Intergenic
1152777619 17:82212684-82212706 TCCGACAGGACGGCAGCTGCTGG + Intronic
1152954669 18:28335-28357 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
1153010778 18:536478-536500 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1153939235 18:9963127-9963149 TTAACCAGGTCCGCAGCTGCAGG + Intergenic
1154100374 18:11467409-11467431 TCCCTCAGGCCCTCAGCTGCTGG + Intergenic
1157729360 18:49990372-49990394 TCCAGCGGGTGCACAGCTGGGGG - Intronic
1158703783 18:59772194-59772216 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1159570296 18:70104723-70104745 TCCAGCAGACCTGCAGCTGAGGG - Intronic
1160414950 18:78703375-78703397 TCCGGCAGGTGAGCAGCCGCTGG - Intergenic
1160507293 18:79434274-79434296 CCCAGCAGGGACGCGGCTGCAGG - Intronic
1160938836 19:1610529-1610551 TCCAGGAGGTCCCCAGCACCGGG + Exonic
1162066230 19:8126848-8126870 CCCACCAGGTCCTGAGCTGCAGG + Intronic
1163628902 19:18406684-18406706 GCCCGCAGGTCCGCTGCTGGTGG + Intergenic
1163742236 19:19022579-19022601 TCCAGCATGCCTGCAGCTGCAGG + Intronic
1164321537 19:24152775-24152797 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1165011102 19:32846951-32846973 TCCAGCAGACCTGCAGCTGAGGG + Intronic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1166930302 19:46297992-46298014 TCCAGCAGAGCTGCACCTGCTGG - Intronic
1167382656 19:49147832-49147854 TCCAGCAAGTCCACAGGTGATGG + Intronic
926524230 2:13956693-13956715 TCCAGCAGGTTCGCAGGTGAAGG - Intergenic
926973676 2:18491857-18491879 TCACCCAGGTCAGCAGCTGCAGG - Intergenic
928401266 2:30980302-30980324 TCCTGCTGCTCCGCAGCTGTGGG - Intronic
928850014 2:35734396-35734418 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
930893782 2:56421943-56421965 TCCAACAGACCCGCAGCTGAGGG + Intergenic
931434173 2:62232764-62232786 TCGAGCAGGTACTCAGTTGCAGG - Intergenic
931441609 2:62294162-62294184 CACAGCATGTCTGCAGCTGCAGG - Intergenic
932377471 2:71250665-71250687 TCCAACAGATCTGCAGCTGAGGG - Intergenic
934028063 2:88017277-88017299 TCCCCCACCTCCGCAGCTGCGGG - Intergenic
935351502 2:102155014-102155036 TCCAGGAGCTCAGCAGTTGCAGG - Intronic
935369063 2:102325267-102325289 TCCAACAGATCTGCAGCTGAGGG + Intronic
935551016 2:104453995-104454017 TCCACGAGATCCGCATCTGCGGG - Intergenic
935566027 2:104608204-104608226 TCCAACAGATCTGCAGCTGAGGG + Intergenic
935863756 2:107362819-107362841 TGCAGCAGGTCGGCAGATGCTGG + Intergenic
936278888 2:111121513-111121535 ACGAGCAGGTCCTCAGCTCCCGG - Intronic
937489540 2:122351516-122351538 TCCAACAGATCTGCAGCTGAGGG - Intergenic
937573616 2:123392560-123392582 TCCAGCAGATCTGCAGCAGAGGG + Intergenic
937807391 2:126161658-126161680 TCCAGCAGATCTGCAGCAGAGGG + Intergenic
938065034 2:128277276-128277298 TGCAGCAGGACCGCAGCTTAGGG - Intronic
940720674 2:157279073-157279095 TCCAACAGATCTGCAGCTGAGGG - Intronic
941153418 2:161943261-161943283 TCCAGCTGTTCCGGATCTGCTGG + Intronic
941934480 2:170972400-170972422 TCCAGGACGGCCGCTGCTGCAGG + Intergenic
942873664 2:180765983-180766005 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
943350812 2:186793873-186793895 TCCAGCAGATCTGCAGCAGAGGG + Intergenic
944262458 2:197692765-197692787 TCCAACAGATCTGCAGCTGAGGG - Intergenic
945161783 2:206899472-206899494 TCCAACAGATCTGCAGCTGAGGG - Intergenic
945597391 2:211812276-211812298 TCCAGCAGACCTGCAGCTGAGGG - Intronic
946842870 2:223836075-223836097 GCCAGCAAGACCGCAGTTGCTGG - Intronic
947098357 2:226592076-226592098 TCCAGCTGGCCAGCAGCAGCAGG - Intergenic
948037821 2:234873508-234873530 TCAAGCAGGTACCCAGCTGCTGG + Intergenic
1169041858 20:2501727-2501749 TCCAACAGATCTGCAGCTGAAGG + Intronic
1169179551 20:3551308-3551330 TCCAGCCAGTCAGCAGCTGGGGG - Intronic
1169929688 20:10818887-10818909 TCCAGCAGGTGGGAAGTTGCAGG + Intergenic
1171381652 20:24738197-24738219 TCCAGTAGGTCTGCAGCTCAGGG + Intergenic
1171436094 20:25125802-25125824 CCCAGCAGATCCGATGCTGCTGG + Intergenic
1171454697 20:25261395-25261417 TCCAGCAGACCTGCAGCTGAAGG + Intronic
1171772213 20:29331385-29331407 TCCAACAGATCAGCAGCTGAGGG + Intergenic
1172240944 20:33412222-33412244 TCCAGCAGGGCCCCAGAAGCTGG - Intronic
1173475128 20:43353433-43353455 GCCAGCTGATCCCCAGCTGCTGG - Intergenic
1174124109 20:48290085-48290107 CCCAGCAGGTACCAAGCTGCAGG - Intergenic
1174990047 20:55499812-55499834 TCCAGCAGGCCTGCAGCAGAGGG - Intergenic
1176063111 20:63180780-63180802 GCCAGCAGCTCAGCTGCTGCAGG - Intergenic
1176669565 21:9720141-9720163 TCCTGCAGGTGCACAGATGCAGG - Intergenic
1179084554 21:38206012-38206034 TCCAGCTGCTCTGGAGCTGCTGG - Intronic
1179800912 21:43811157-43811179 GCCAGGAGGGCCACAGCTGCAGG - Intergenic
1180140420 21:45890116-45890138 TCCAGCAGCTACTCTGCTGCGGG + Intronic
1180156766 21:45981877-45981899 TCCAGCAGGCCTGCAGCAGCAGG - Exonic
1180541091 22:16448098-16448120 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1180630984 22:17229822-17229844 GCCAGCAGGTCGGGAGCTGGGGG - Intergenic
1181171270 22:21011575-21011597 TCCAACAGGTCCACATCTGGGGG + Intronic
1181573905 22:23782153-23782175 TCAAGCAGGTCCACAGTGGCGGG + Intronic
1183698230 22:39435346-39435368 CCCAGCAGGTCCCCGGCTGCCGG + Intronic
1183727552 22:39597920-39597942 CCCACCAGGCCCCCAGCTGCAGG - Intronic
1184599438 22:45533839-45533861 GCCAGCGGGACAGCAGCTGCGGG + Exonic
1184657365 22:45948497-45948519 CCGAGCAGAGCCGCAGCTGCCGG - Intronic
1185021269 22:48377645-48377667 TCCTTCAGGTCCCCGGCTGCTGG - Intergenic
1185089087 22:48755900-48755922 TCCAGCAGGTCCCTAGCTTGAGG + Intronic
1185331808 22:50255355-50255377 TCCAGGAGGTTCACAGCTGCGGG + Exonic
949342605 3:3045544-3045566 TCCAGCAGACCTGCAGCTGAGGG + Intronic
949632491 3:5943809-5943831 TCCAACAGACCTGCAGCTGCGGG - Intergenic
950299801 3:11867236-11867258 TCCAACAGATCCGCAGCTGAGGG - Intergenic
950302691 3:11895051-11895073 TCCAACAGACCCGCAGCTGAGGG + Intergenic
950371204 3:12532197-12532219 ACCAGCAGGTCTGCAGGGGCAGG - Intronic
951167348 3:19498807-19498829 TCCAGCAGACCTGCAGCTGAGGG - Intronic
951653630 3:24981022-24981044 TCCAGCAGACCTGCAGCTGAAGG - Intergenic
952287243 3:31981037-31981059 TCCAGCCGGTCGGCGGCGGCCGG - Exonic
952962169 3:38599098-38599120 TCCAGCAGGACAGGAGCTGGGGG - Intronic
953516050 3:43592512-43592534 TCCAGCAGACCTGCAGCTGAGGG + Intronic
954833662 3:53445975-53445997 TCCAGCAGACCTGCAGCTGAGGG - Intergenic
955211570 3:56946043-56946065 TCCAACAGACCCGCAGCTGAGGG + Intronic
955435971 3:58899366-58899388 TCCAGCCAGTCAGCAGCAGCAGG - Intronic
955854332 3:63256484-63256506 TCCAACAGACCCGCAGCTGAGGG + Intronic
957306726 3:78467295-78467317 TCCAACAGGCCTGCAGCTGAGGG - Intergenic
958108978 3:89114779-89114801 GCCAGCAGATCCGCGGCAGCAGG - Intronic
958171365 3:89944316-89944338 TCCAACAGATCTGCAGCTGAGGG - Intergenic
958496177 3:94846807-94846829 TCCAACAGATCTGCAGCTGAGGG + Intergenic
958624430 3:96606566-96606588 TCCAACAGATCTGCAGCTGAGGG - Intergenic
960730375 3:120720100-120720122 TCCAACAGATCTGCAGCTGAGGG + Intronic
960835976 3:121907610-121907632 TCCAACAGACCCGCAGCTGAGGG - Intronic
961420865 3:126801979-126802001 TCCAACAGATCTGCAGCTGAGGG + Intronic
961956118 3:130805536-130805558 TCCAACAGATCTGCAGCTGAGGG + Intergenic
961984756 3:131121213-131121235 TCCAGCAGACCTGCAGCTGAGGG - Intronic
962967829 3:140370794-140370816 TCCAGCATGCCCCCAACTGCTGG - Intronic
963581270 3:147129414-147129436 TCCAACAGATCTGCAGCTGAAGG - Intergenic
964564543 3:158035044-158035066 TCCAACAGATCTGCAGCTGAGGG + Intergenic
967113919 3:186319472-186319494 TAGAGCAGGTCAACAGCTGCAGG + Intronic
967981709 3:195069816-195069838 TCCACCAGGTGCACAGCTGCCGG + Exonic
968235866 3:197029749-197029771 CCGAGGAGGTCCGCAGCAGCCGG + Exonic
969188205 4:5495802-5495824 TCCAACAGATCTGCAGCTGAGGG - Intronic
969703085 4:8778385-8778407 ACCAGCAGGCACTCAGCTGCCGG + Intergenic
970348281 4:15174783-15174805 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
970424466 4:15933604-15933626 TCCTCCAGGCCCGCAGTTGCTGG - Intergenic
970496362 4:16629516-16629538 TCCAGCAGACCTGCAGCTGAGGG + Intronic
974075352 4:57163885-57163907 TCCAGATGGTCCGCACCTGGCGG + Intergenic
975287055 4:72632948-72632970 TCCAGCAGATCTGCAGCTGAGGG + Intergenic
975287382 4:72636569-72636591 TCCAACAGATCTGCAGCTGAAGG - Intergenic
975751018 4:77523966-77523988 TCCAACAGATCTGCAGCTGAGGG - Intronic
976899673 4:90158100-90158122 TCCAACAGATCTGCAGCTGAGGG - Intronic
977219718 4:94325016-94325038 TCCAGCAGACCTGCAGCTGAGGG - Intronic
977771643 4:100868047-100868069 TCCAGCAGACCTGCAGCTGAGGG - Intronic
978020852 4:103810074-103810096 TCCAGCAGACCTGCAGCTGAGGG - Intergenic
978096759 4:104787764-104787786 TCCAACAGATCTGCAGCTGAGGG + Intergenic
978176171 4:105734906-105734928 TCCAACAGATCTGCAGCTGAGGG - Intronic
979512333 4:121568174-121568196 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
979516657 4:121617093-121617115 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
980217910 4:129875966-129875988 TCCAACAGATCTGCAGCTGAGGG - Intergenic
980848840 4:138355648-138355670 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
981479942 4:145228332-145228354 TCCAGCAGACCTGCAGCTGAGGG - Intergenic
981671648 4:147293347-147293369 TCCAGCAGACCTGCAGCAGCGGG + Intergenic
982328043 4:154149804-154149826 TCCAGCAGACCTGCAGCTGAGGG - Intergenic
982785596 4:159533295-159533317 TCCAGCAGACCTGCAGCTGAGGG - Intergenic
982909122 4:161117501-161117523 TCCAGCAGATCTGCAGCAGAGGG - Intergenic
983385518 4:167056219-167056241 TCCAACAGATCTGCAGCTGAGGG + Intronic
985405211 4:189631325-189631347 TCCTGCAGGTGCACAGATGCAGG + Intergenic
985807756 5:2059583-2059605 TCCAGCTTGTCCTCTGCTGCAGG - Intergenic
986719937 5:10553693-10553715 TCCAGCCTCTCAGCAGCTGCGGG + Intergenic
987482160 5:18472594-18472616 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
988187761 5:27889127-27889149 TCCAACAGATCTGCAGCTGAGGG - Intergenic
988541728 5:32116172-32116194 ACCAGCAGGACAGCAGCAGCTGG + Intergenic
988687696 5:33540717-33540739 TCCAACAGCTCTGCAGCTGAGGG + Intronic
989725294 5:44579721-44579743 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
989804365 5:45585751-45585773 TCCAGCAGACCTGCAGCTGAGGG - Intronic
989845166 5:46131799-46131821 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
989956605 5:50367667-50367689 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
990230967 5:53712578-53712600 TCCAGCTGGCCAGCAGCAGCAGG - Intergenic
990899011 5:60729752-60729774 TCCAACAGATCTGCAGCTGAGGG + Intergenic
991025628 5:62026516-62026538 TCCAGCAGAACTGCAGCTGAGGG - Intergenic
992016305 5:72578214-72578236 TCCAACAGACCCGCAGCTGAGGG + Intergenic
992632074 5:78691232-78691254 GCCAGCAGGTAAGCAGCAGCTGG - Intronic
992899324 5:81277544-81277566 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
993266526 5:85732729-85732751 TCCAACAGATCTGCAGCTGAGGG + Intergenic
993688565 5:90970620-90970642 TCCAGCAGACCTGCAGCTGAGGG + Intronic
994006586 5:94844659-94844681 CCCAGCAGCTCCCCAACTGCTGG + Intronic
994270567 5:97771828-97771850 TCCAACAGATCTGCAGCTGAGGG - Intergenic
995480468 5:112587195-112587217 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
996668336 5:126086849-126086871 TCCAGCAGATCAGCAGCTGAGGG + Intergenic
996935363 5:128942834-128942856 TCCAACAGATCTGCAGCTGAGGG - Intronic
997187601 5:131898160-131898182 TCCAGCAGACCTGCAGCTGAGGG - Intronic
997351753 5:133236093-133236115 GCCAGCAGGTCCACAGCGCCAGG - Intronic
997469364 5:134108348-134108370 TCCAGCAGGGCCACAGATGAAGG + Intergenic
997578573 5:135003179-135003201 TCCAACAGATCTGCAGCTGAGGG - Intronic
997692104 5:135833979-135834001 TCCAGCAGGGACTCAGCTGTGGG - Intergenic
998241793 5:140452633-140452655 TCCAGCAGACCTGCAGCTGAGGG + Intronic
999143700 5:149379247-149379269 TCCAGGCGGGCAGCAGCTGCAGG - Exonic
1000248496 5:159470294-159470316 TCCAGCAGGCCCGATGCTGGAGG + Intergenic
1000499944 5:162036152-162036174 TCCAGCAGACCTGCAGCTGAGGG - Intergenic
1001570253 5:172726046-172726068 TCCACCAGTTCCCCAGCCGCAGG + Intergenic
1001603363 5:172943443-172943465 TCCAGCCTGTCTGCCGCTGCTGG + Intronic
1002903921 6:1433821-1433843 TCCAACAGACCCGCAGCTGAGGG - Intergenic
1003236867 6:4302629-4302651 TGCAGCAGGTCTCCAGCTGGAGG - Intergenic
1003448971 6:6212444-6212466 TCCAACAGATCTGCAGCTGAGGG + Intronic
1003590391 6:7432196-7432218 TCCAGCAAAGCCGCAGCTCCGGG - Intergenic
1004078122 6:12364043-12364065 TCCAGCAAGGCCTCAGCTGAGGG - Intergenic
1006719154 6:36138872-36138894 TCCAGCAGGTCCGCAGCTGCAGG - Exonic
1008183590 6:48363869-48363891 TCCAGCAGATCTGCAGCTGAGGG + Intergenic
1008801021 6:55368668-55368690 TCCAACAGATCTGCAGCTGAGGG - Intronic
1009382868 6:63053829-63053851 TCTAACAGGGCCTCAGCTGCAGG - Intergenic
1009410521 6:63360882-63360904 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1009662470 6:66631735-66631757 TCCAACAGGCCTGCAGCTGAGGG + Intergenic
1011181580 6:84627124-84627146 TCCAACAGACCCGCAGCTGAGGG + Intergenic
1011306696 6:85935667-85935689 TCCAACAGATCTGCAGCTGAAGG - Intergenic
1011776685 6:90739012-90739034 TCCAGCAGATCTGCAGCAGAGGG - Intergenic
1011838852 6:91470197-91470219 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1012220105 6:96638655-96638677 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1012598068 6:101062879-101062901 TCCAACAGGCCTGCAGCTGAGGG + Intergenic
1013648770 6:112172199-112172221 TCTGGCTGGTCAGCAGCTGCAGG - Intronic
1013869489 6:114739867-114739889 TCCAGAAGGTGAGCAGATGCTGG + Intergenic
1016102144 6:140115607-140115629 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1016339779 6:143049921-143049943 ACAACCAGGTCTGCAGCTGCAGG + Intergenic
1017231667 6:152079373-152079395 TCCAACAGGCCTGCAGCTGAGGG + Intronic
1017249016 6:152260082-152260104 TCCAGGAGGTCTGCAGATGCCGG + Intronic
1018126153 6:160684950-160684972 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1019437845 7:1031084-1031106 CCCAGCAGGTCGGCAGGTCCTGG + Intronic
1019800746 7:3086526-3086548 TCCCGCATGTCCTCAGCTGATGG + Intergenic
1020120634 7:5501252-5501274 TCCAGCAGGTCATCAACGGCGGG - Exonic
1020659425 7:10965322-10965344 TCCAGCAGACCTGCAGCTGAGGG - Intergenic
1022630851 7:32082768-32082790 TCCAGCAGACCTGCAGCTGAGGG + Intronic
1022848356 7:34234792-34234814 TCCAGCAGGCCTGCAGCAGAGGG - Intergenic
1023509319 7:40934193-40934215 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1023646263 7:42318977-42318999 TCCAGCACGTTCCCAGCTGTGGG + Intergenic
1024380073 7:48685844-48685866 TCCAGCAGATCTGCAGCTGAGGG + Intergenic
1027843449 7:83342511-83342533 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
1027983051 7:85250635-85250657 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
1028070890 7:86449002-86449024 TCCTGCAAGTCCAAAGCTGCTGG - Intergenic
1028643762 7:93073038-93073060 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1028830766 7:95324538-95324560 CCCAGCAGGGCTGCGGCTGCAGG - Exonic
1031664491 7:124467957-124467979 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1031822027 7:126514165-126514187 CCCAGCAAGTCCGCAGATGCTGG + Intronic
1032012205 7:128354030-128354052 TTCAGCAGGACCGCAGCCACAGG + Intronic
1033962302 7:146929354-146929376 TCCAACAGGCCTGCAGCTGAGGG + Intronic
1034208882 7:149345064-149345086 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1034345596 7:150383653-150383675 CCCAGCAGGTCCTCACTTGCTGG - Intronic
1034544772 7:151782586-151782608 TCCAGCAGGAACACGGCTGCGGG - Intronic
1036307276 8:7611484-7611506 TCCAGCAGCTCCGAAGCCACTGG + Intergenic
1036311391 8:7686610-7686632 TCCAGCAGCTCCGAAGCCACTGG - Intergenic
1036358120 8:8059471-8059493 TCCAGCAGCTCCGAAGCCACTGG + Intergenic
1036536287 8:9655658-9655680 TCCAACAGGCCTGCAGCTGAGGG + Intronic
1036705536 8:11043531-11043553 TCCAGGGGCTCTGCAGCTGCTGG - Intronic
1036892829 8:12607475-12607497 TCCAGCAGCTCCGAAGCCACTGG - Intergenic
1037050064 8:14361938-14361960 TCCAGCAGACCTGCAGCTGAGGG - Intronic
1037641071 8:20743593-20743615 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1039624256 8:39031907-39031929 TCCAACAGATCTGCAGCTGAGGG - Intronic
1039707356 8:40021623-40021645 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1039832454 8:41225878-41225900 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1040140537 8:43904505-43904527 TCCAGCAGACCTGCAGCTGAGGG - Intergenic
1040708079 8:50153629-50153651 TCCAGCAGACCTGCAGCTGAGGG - Intronic
1041772065 8:61482112-61482134 TCCAACAGATCTGCAGCTGAGGG + Intronic
1041997786 8:64084560-64084582 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1043366234 8:79536723-79536745 TCCAGCAGACCTGCAGCTGAAGG - Intergenic
1043801911 8:84620820-84620842 TCCAGCAGACCTGCAGCTGAGGG - Intronic
1043884320 8:85581019-85581041 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1044037691 8:87327030-87327052 TCCAACAGATCTGCAGCTGAGGG - Intronic
1044601369 8:94008848-94008870 TCCAACAGACCCGCAGCTGGGGG - Intergenic
1044702281 8:94975511-94975533 TCCAGGAGGCCAGCAGCTGCAGG - Intronic
1046115160 8:109776196-109776218 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1048574410 8:135679580-135679602 TCCTGCAGGGCCGAAGGTGCAGG + Intergenic
1049612118 8:143560632-143560654 TGCAGCAGCTGCGCAGCCGCGGG + Exonic
1050492488 9:6203420-6203442 TCCAGCAGATCTGCAGCAGAGGG + Intergenic
1051122041 9:13761925-13761947 TCCAGCAGACCAGCAGCTACTGG + Intergenic
1051223533 9:14875901-14875923 TCCAGCAGACCTGCAGCTGAGGG - Intronic
1051940122 9:22495703-22495725 TCCACCAGATCTGCAGCTGAGGG - Intergenic
1052131938 9:24858710-24858732 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
1052441123 9:28497884-28497906 TCCAGCAGACCTGCAGCTGAGGG - Intronic
1052752846 9:32509485-32509507 TCCAGCAGACCTGCAGCTGAGGG + Intronic
1054845029 9:69785659-69785681 ACCAGCATGTCCTCAGCTTCTGG - Intergenic
1056846407 9:90041512-90041534 CCCAGCAGGTTGCCAGCTGCTGG + Intergenic
1057302305 9:93893992-93894014 TCCTGCAGCTGCGCATCTGCGGG + Intergenic
1057302306 9:93893993-93894015 GCCCGCAGATGCGCAGCTGCAGG - Intergenic
1058085945 9:100748701-100748723 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1058134494 9:101291706-101291728 TCCAACAGACCCGCAGCTGAGGG + Intronic
1058958256 9:109969225-109969247 CTCAGCAGCTCCACAGCTGCTGG + Intronic
1059611618 9:115903310-115903332 TACATCAGGTCCGCAGCCTCTGG - Intergenic
1060375842 9:123114785-123114807 TCCAGCAGGTCCCCCGCCCCCGG + Intronic
1061996489 9:134188788-134188810 CCCAGCAGGTCAGAAGCTCCAGG - Intergenic
1062070180 9:134551222-134551244 TTCCCCAGGGCCGCAGCTGCGGG + Intergenic
1062318589 9:135979726-135979748 GCCAGCAGGGACTCAGCTGCAGG + Intergenic
1203358802 Un_KI270442v1:193078-193100 TCCAGCAGACCTGCAGCTGAGGG - Intergenic
1203656299 Un_KI270753v1:726-748 TCCTGCAGGTGCACAGATGCAGG + Intergenic
1186354315 X:8773826-8773848 TCCAGCAGATCTGCAGCAGAGGG + Intergenic
1188109615 X:26181766-26181788 TCCAACAGACCCGCAGCTGAGGG - Intergenic
1190113980 X:47613747-47613769 TCCATCAGGCCAGCAGCTCCCGG - Intronic
1190554927 X:51624032-51624054 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
1191222454 X:58003640-58003662 TCTAACAGGTCCCCTGCTGCAGG - Intergenic
1191757221 X:64606723-64606745 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1192383386 X:70639684-70639706 TCCAGCAGACCTGCAGCTGAGGG + Intronic
1192385294 X:70661783-70661805 TCCAGCAGACCTGCAGCTGAGGG + Intronic
1192674680 X:73183263-73183285 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
1192678926 X:73230729-73230751 TCCAACAGGCCTGCAGCTGAGGG + Intergenic
1192761588 X:74100293-74100315 TCCAACAGGCCTGCAGCTGAGGG - Intergenic
1192987499 X:76415653-76415675 TCCAACACGTCTGCAGCTGAGGG + Intergenic
1193011066 X:76675300-76675322 TCCAGCAGAGCTGCAGCTGTGGG + Intergenic
1193030909 X:76897103-76897125 TCCAACAGGCCTGCAGCTGAGGG + Intergenic
1193167139 X:78294214-78294236 TCCAGCAGACCTGCAGCTGATGG - Intronic
1193757544 X:85427063-85427085 TCCAGCAGACCTGCAGCTGAGGG - Intergenic
1193774310 X:85623314-85623336 TCCAGCAGACCTGCAGCTGAGGG + Intergenic
1195764145 X:108277907-108277929 TCCAGCAGACCTGCAGCTGAGGG + Intronic
1196612688 X:117732951-117732973 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1196853650 X:119962368-119962390 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1198042159 X:132863984-132864006 TCCAGCAGGCCTGCAGCAGAGGG + Intronic
1198584593 X:138106169-138106191 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1199383855 X:147201181-147201203 TCCAGCAGATCTGCAGCTGAGGG + Intergenic
1200098231 X:153674004-153674026 CCCAGCCGGGCCGCAGCTCCGGG - Exonic
1200407710 Y:2830172-2830194 TCCAGCAGGCCTGCAGCAGAGGG + Intergenic
1200589013 Y:5046338-5046360 TCCAACAGATCTGCAGCTGAGGG - Intronic
1200676236 Y:6149735-6149757 TCCAACAGACCCGCAGCTGAGGG + Intergenic
1200833435 Y:7710347-7710369 TCCAACAGACCTGCAGCTGCGGG - Intergenic
1201182244 Y:11359681-11359703 TCCAACAGATCTGCAGCTGAGGG + Intergenic
1201413343 Y:13722852-13722874 TCCAGCAGAACTGCAGCTGAGGG + Intergenic
1201544675 Y:15148687-15148709 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1201702823 Y:16902552-16902574 TCCAACAGATCTGCAGCTGAAGG + Intergenic
1202020719 Y:20462488-20462510 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1202034656 Y:20620065-20620087 TCCAACAGATCTGCAGCTGAGGG - Intergenic
1202170858 Y:22041823-22041845 TCCAGCAGATGTGCAGCTGAGGG + Intergenic
1202220505 Y:22544550-22544572 TCCAGCAGATGTGCAGCTGAGGG - Intergenic
1202322608 Y:23651113-23651135 TCCAGCAGATGTGCAGCTGAGGG + Intergenic
1202357270 Y:24064588-24064610 TCCAACAGAGCAGCAGCTGCGGG + Intergenic
1202513507 Y:25605526-25605548 TCCAACAGAGCAGCAGCTGCGGG - Intergenic
1202548165 Y:26018943-26018965 TCCAGCAGATGTGCAGCTGAGGG - Intergenic
1202577255 Y:26340512-26340534 TCCAACAGATCTGCAGCTGAGGG + Intergenic