ID: 1006719920

View in Genome Browser
Species Human (GRCh38)
Location 6:36143356-36143378
Sequence TACGGAGCTGTTCCTCCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 73}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006719920_1006719926 7 Left 1006719920 6:36143356-36143378 CCTGATGGAGGAACAGCTCCGTA 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1006719926 6:36143386-36143408 ACCCAGTGTGCACGGGTGCCCGG 0: 1
1: 0
2: 0
3: 11
4: 143
1006719920_1006719925 0 Left 1006719920 6:36143356-36143378 CCTGATGGAGGAACAGCTCCGTA 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1006719925 6:36143379-36143401 AGGGTGAACCCAGTGTGCACGGG 0: 1
1: 0
2: 3
3: 12
4: 140
1006719920_1006719934 29 Left 1006719920 6:36143356-36143378 CCTGATGGAGGAACAGCTCCGTA 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1006719934 6:36143408-36143430 GAGCTGCCTGCGTGAGGCTGGGG 0: 1
1: 0
2: 3
3: 32
4: 285
1006719920_1006719932 27 Left 1006719920 6:36143356-36143378 CCTGATGGAGGAACAGCTCCGTA 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1006719932 6:36143406-36143428 CGGAGCTGCCTGCGTGAGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 194
1006719920_1006719933 28 Left 1006719920 6:36143356-36143378 CCTGATGGAGGAACAGCTCCGTA 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1006719933 6:36143407-36143429 GGAGCTGCCTGCGTGAGGCTGGG 0: 1
1: 0
2: 1
3: 20
4: 233
1006719920_1006719929 23 Left 1006719920 6:36143356-36143378 CCTGATGGAGGAACAGCTCCGTA 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1006719929 6:36143402-36143424 TGCCCGGAGCTGCCTGCGTGAGG 0: 1
1: 0
2: 0
3: 15
4: 151
1006719920_1006719924 -1 Left 1006719920 6:36143356-36143378 CCTGATGGAGGAACAGCTCCGTA 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1006719924 6:36143378-36143400 AAGGGTGAACCCAGTGTGCACGG 0: 1
1: 0
2: 1
3: 23
4: 169
1006719920_1006719935 30 Left 1006719920 6:36143356-36143378 CCTGATGGAGGAACAGCTCCGTA 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1006719935 6:36143409-36143431 AGCTGCCTGCGTGAGGCTGGGGG 0: 1
1: 0
2: 3
3: 20
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006719920 Original CRISPR TACGGAGCTGTTCCTCCATC AGG (reversed) Intronic
901471169 1:9457444-9457466 TACAGAGCTGTGCGACCATCAGG + Intergenic
903466148 1:23554033-23554055 TGTGGAGCTGTGCTTCCATCGGG - Intergenic
906065037 1:42974720-42974742 TATGGAGCTATTCCTCTGTCGGG + Intergenic
906999187 1:50832751-50832773 TAGGGAGCTGTTTCCCCATGTGG + Intronic
907364849 1:53949612-53949634 TTCTGAGCTGTTCCTCCAGTAGG - Intronic
915294415 1:154910076-154910098 TATGGAGCTGACCATCCATCCGG + Intergenic
920182522 1:204141233-204141255 CACGGAGCTGTTCTTCCGGCTGG - Intronic
922194920 1:223351600-223351622 TCCACAGCTGTTCCTGCATCTGG - Intronic
1065634233 10:27714113-27714135 TTTGGAGCTGTTCCTCCCTTTGG - Intronic
1066966383 10:42269988-42270010 TCTGGAGCTGTTGCTCCCTCTGG + Intergenic
1067746091 10:48937729-48937751 TAATGAGCTGTTCATCCAGCAGG + Intronic
1069829158 10:71272016-71272038 CACAAAGCTCTTCCTCCATCTGG - Intronic
1074858387 10:117490512-117490534 TACGGTGCTCTTGCTCCTTCTGG + Intergenic
1092946977 12:13465725-13465747 TCCAGAGCTGTTCCTCAGTCTGG - Intergenic
1094292924 12:28872414-28872436 TACCTATCTGTTTCTCCATCTGG - Intergenic
1104519096 12:129456520-129456542 AATGGAGCTGTCCCTCCATGTGG + Intronic
1105505910 13:21009695-21009717 GTAGCAGCTGTTCCTCCATCTGG - Intronic
1108632762 13:52302538-52302560 TACAGGGCTGTTCCTCAAGCTGG + Intergenic
1108653936 13:52510059-52510081 TACAGGGCTGTTCCTCAAGCTGG - Intergenic
1110040984 13:70758264-70758286 TACATAGATTTTCCTCCATCAGG + Intergenic
1111132632 13:83996757-83996779 TATGCAACTGTTCCTCCATCTGG - Intergenic
1118875022 14:69776880-69776902 TACAGAGTTGTTCTCCCATCAGG + Intronic
1119169891 14:72526739-72526761 TAGGAAGCTGTTGCTCCTTCTGG - Intronic
1119898856 14:78243273-78243295 TACGGGGCTGCTCCTCTACCTGG + Intronic
1122074988 14:99230219-99230241 TGCAGAGCTGTGGCTCCATCAGG + Intronic
1127723037 15:61721465-61721487 GACGCAGCTGCTCCTCCAACAGG + Intergenic
1136732061 16:32423960-32423982 TCTGGAGCTGTTGCTCCTTCTGG + Intergenic
1202994333 16_KI270728v1_random:93284-93306 TCTGGAGCTGTTGCTCCTTCTGG - Intergenic
1203021020 16_KI270728v1_random:405626-405648 TCTGGAGCTGTTGCTCCTTCTGG - Intergenic
1203039355 16_KI270728v1_random:678784-678806 TCTGGAGCTGTTGCTCCTTCTGG - Intergenic
1143444888 17:7001850-7001872 TATGGGGCTGTTCCTCTCTCTGG - Intronic
1149295905 17:55262736-55262758 TAAGGGGCTGGTCCTCAATCTGG + Intergenic
1150231112 17:63550926-63550948 CACGGAGCGGTTCCTCTGTCTGG + Intronic
1156366216 18:36429699-36429721 TGCGGAGCTGCTCCTCCTTCTGG - Intronic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1160815013 19:1031091-1031113 TGCGGAGCTCTGCCTCCTTCTGG - Exonic
1161981527 19:7632752-7632774 AACAGCGCTGTCCCTCCATCCGG + Exonic
1165188404 19:34041278-34041300 AACAGAGCTCTTCCTCCTTCTGG + Intergenic
925110332 2:1330087-1330109 TACACTGCTGTTCCGCCATCAGG + Intronic
925837721 2:7962300-7962322 TAGAGAGCTGTTACTCCATGGGG + Intergenic
925847168 2:8044444-8044466 CAGGGAGCTGCTCCTCCATGGGG - Intergenic
929803787 2:45127220-45127242 AACGGAGCTGCTCATCCTTCAGG + Intergenic
930888400 2:56355018-56355040 TTGGGAGCTGTTCCCCCATCAGG + Intronic
934313666 2:91895280-91895302 TCTGGAGCTGTTGCTCCCTCTGG - Intergenic
934488167 2:94737420-94737442 TGCGGAGCTCTGCCTCCTTCTGG - Intergenic
935626236 2:105174457-105174479 GAGAGAGCTGTTCCTCCTTCTGG - Intergenic
946432423 2:219632730-219632752 TATGGAGCTGTGTATCCATCTGG + Intronic
948853495 2:240719588-240719610 CATGGAGCTGTCCCTCCATGTGG + Intronic
1169998103 20:11582214-11582236 TACTGAGCTGTTACTACATCTGG + Intergenic
1170567566 20:17615630-17615652 GATGGAGCTGTTGCTCCATCAGG - Intronic
1176839391 21:13826780-13826802 TGCGGAGCTCTACCTCCTTCTGG - Intergenic
1179576353 21:42310713-42310735 AACGGAGCTGGTCATCCAGCTGG + Intergenic
1180540409 22:16441185-16441207 TCTGGAGCTGTTGCTCCCTCTGG - Intergenic
1180903984 22:19395483-19395505 TAAGGAGCTTTTGCTCCTTCTGG - Intronic
949509288 3:4754273-4754295 TTGGGTGCTGTTCCTCCATGGGG - Intronic
958942653 3:100332736-100332758 GACACAGCTGTTCCTCCACCAGG + Intergenic
959101542 3:102015806-102015828 TACTGAGCTGTTGCTTCATCTGG - Intergenic
963544374 3:146636788-146636810 TCCAGAGCTGTTCAACCATCAGG - Intergenic
967716699 3:192770955-192770977 CAAGGAGATGTTCCTCCACCTGG - Intergenic
971268122 4:25112494-25112516 TAAGGAGGAGTTCCTCCGTCAGG - Intergenic
975027883 4:69575440-69575462 TCCGGAGCTGTTCATCCCTCTGG + Intergenic
979365821 4:119822179-119822201 TACTGAGCTGTGCCACCTTCGGG - Intergenic
998477793 5:142436104-142436126 TCAGGAGCTGTTACTCCAGCAGG + Intergenic
1000661965 5:163948905-163948927 ATCGGAGCTCTTCCTCCAACTGG - Intergenic
1001692972 5:173646542-173646564 CAAGGAGCTGTTCCTCCACTGGG - Intergenic
1006719920 6:36143356-36143378 TACGGAGCTGTTCCTCCATCAGG - Intronic
1007230546 6:40344947-40344969 GAGGGGGCTGGTCCTCCATCGGG - Intergenic
1013512578 6:110858322-110858344 TGCGGAGCTCTACCTCCTTCTGG - Intronic
1019038655 6:169084345-169084367 TGCTGAGCTGTTCCGCCCTCGGG - Intergenic
1019618879 7:1979866-1979888 AAGGGAGCAGGTCCTCCATCAGG - Intronic
1034565134 7:151908014-151908036 TCCGTAGCTGTTGCTCCACCTGG + Intergenic
1035947960 8:3986220-3986242 TATAAAGCTCTTCCTCCATCTGG - Intronic
1044783944 8:95774997-95775019 TACGGAGCTAATCGTCCAGCTGG + Intergenic
1053480150 9:38410599-38410621 ACTGGAGCTGTTCCTCCAGCTGG + Intronic
1053669622 9:40346944-40346966 TGCGGAGCTCTGCCTCCTTCTGG + Intergenic
1053919418 9:42973184-42973206 TGCGGAGCTCTGCCTCCTTCTGG + Intergenic
1054380755 9:64486964-64486986 TGCGGAGCTCTGCCTCCTTCTGG + Intergenic
1054514992 9:66029347-66029369 TGCGGAGCTCTGCCTCCTTCTGG - Intergenic
1060881239 9:127119677-127119699 AAATAAGCTGTTCCTCCATCTGG - Intronic
1062322539 9:135997416-135997438 TACGGAGCTGGTTCTCCGCCCGG + Intergenic
1187309988 X:18132756-18132778 TCTTGAGCTGTTCCTCCAGCTGG - Intergenic