ID: 1006720666

View in Genome Browser
Species Human (GRCh38)
Location 6:36147992-36148014
Sequence TACCTGGTGCTGTAAGCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006720666_1006720674 14 Left 1006720666 6:36147992-36148014 CCTCTTGCTTACAGCACCAGGTA No data
Right 1006720674 6:36148029-36148051 GCTGTGTTAGTTCCCACAGTAGG No data
1006720666_1006720677 26 Left 1006720666 6:36147992-36148014 CCTCTTGCTTACAGCACCAGGTA No data
Right 1006720677 6:36148041-36148063 CCCACAGTAGGAACACAGCTGGG No data
1006720666_1006720667 -8 Left 1006720666 6:36147992-36148014 CCTCTTGCTTACAGCACCAGGTA No data
Right 1006720667 6:36148007-36148029 ACCAGGTACCATACCCCGCCTGG No data
1006720666_1006720675 25 Left 1006720666 6:36147992-36148014 CCTCTTGCTTACAGCACCAGGTA No data
Right 1006720675 6:36148040-36148062 TCCCACAGTAGGAACACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006720666 Original CRISPR TACCTGGTGCTGTAAGCAAG AGG (reversed) Intergenic
No off target data available for this crispr