ID: 1006726846

View in Genome Browser
Species Human (GRCh38)
Location 6:36205385-36205407
Sequence TCATCTCTGGAGCAGCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006726846_1006726848 0 Left 1006726846 6:36205385-36205407 CCACACTGCTGCTCCAGAGATGA 0: 1
1: 0
2: 0
3: 27
4: 232
Right 1006726848 6:36205408-36205430 AGCAAAGCTTTATGTGAGTCTGG 0: 1
1: 0
2: 0
3: 13
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006726846 Original CRISPR TCATCTCTGGAGCAGCAGTG TGG (reversed) Intronic
900094688 1:935527-935549 CCCTCCCTGGAGCAGCCGTGGGG + Intronic
901472502 1:9467425-9467447 TCATCTCTGGGCCCGCACTGCGG + Intergenic
903271565 1:22191802-22191824 GCCTCTCTGGATCTGCAGTGGGG + Intergenic
903412588 1:23158037-23158059 TCATCTCTGGGGCAACTGTAAGG - Intronic
903444792 1:23415544-23415566 CCATGTCTGGAGCACCTGTGTGG - Intronic
904389219 1:30170078-30170100 CCATCTCAGGGGCAGCAGCGTGG - Intergenic
905895152 1:41540948-41540970 TTATGTCTGGAGCACCAGTGTGG - Intronic
906246215 1:44276139-44276161 TCCTCCCTGGGGCAGGAGTGAGG - Intronic
906544525 1:46611947-46611969 TCATCTCTGCAGAGGCTGTGTGG - Intronic
907314568 1:53560277-53560299 TCATCTCTGTCCCAGCACTGAGG + Intronic
911157846 1:94654292-94654314 TCATCTCTGGGACAGCAGAGTGG + Intergenic
911993707 1:104736093-104736115 TGCTCTCTGTAGCAACAGTGCGG + Intergenic
912802657 1:112730197-112730219 TCTTCTCTGTAGCAGGGGTGAGG - Intergenic
915980725 1:160418345-160418367 TGATCTGTGGACCAGCGGTGTGG - Intronic
916551699 1:165855953-165855975 TCATCTCTGGTCCAGCGGTTGGG + Intronic
919128270 1:193423314-193423336 TCCTCTCTAGAACAGCAGTTAGG + Intergenic
922149910 1:222991376-222991398 TCACCTCTGGAGTAGCTGTGAGG + Intronic
923777063 1:236988773-236988795 AGATCTCTCTAGCAGCAGTGTGG - Intergenic
924891415 1:248285297-248285319 CCATCTGGGGAGCAGTAGTGAGG - Intergenic
1063077029 10:2727678-2727700 TCAGCTTTGAAGCAGCAGTTCGG + Intergenic
1065028062 10:21557751-21557773 TCATCTCTGTGGCTGGAGTGGGG + Intronic
1066046268 10:31598208-31598230 GCATCTGGGAAGCAGCAGTGTGG + Intergenic
1068777903 10:60887858-60887880 TCCACTCTTGAGGAGCAGTGTGG + Intronic
1069239674 10:66123825-66123847 TCATGGCTGGAGCAGCTGGGAGG + Intronic
1070757265 10:79001117-79001139 TCCTCTCTGGAGCACCTCTGGGG + Intergenic
1075223919 10:120608407-120608429 TCATCTCTGAAGCTGAGGTGGGG - Intergenic
1075442978 10:122494198-122494220 TCATCTCTGCAGCTGGACTGCGG + Intronic
1075597903 10:123745752-123745774 TTATCTGTGGAGCATCAGTTTGG - Exonic
1076452887 10:130568995-130569017 CCATCTCTGGAGGAGCAGGTTGG + Intergenic
1076558588 10:131346361-131346383 ACATCTCTGGACCAGCATTGTGG - Intergenic
1076839613 10:133039552-133039574 CCATCTGTGGAGCAGCTGTGAGG + Intergenic
1077640119 11:3873766-3873788 TCAGCTCAGGAGGAGCAGTTAGG - Intronic
1078355490 11:10628996-10629018 CCATCTCTTGAGCAGCAGCAGGG - Intronic
1078369684 11:10734627-10734649 TCATGTCTGGGGGATCAGTGTGG + Intergenic
1078490534 11:11763991-11764013 TCACATTTGGAGAAGCAGTGAGG - Intergenic
1078730577 11:13970498-13970520 CCATCTGTGGGGCAGGAGTGTGG + Intronic
1079691702 11:23426522-23426544 TCATTTCTGGAGGCCCAGTGGGG - Intergenic
1081765026 11:45604483-45604505 CCATCTCTGGTGGAGGAGTGTGG - Intergenic
1082014300 11:47472880-47472902 TTCTCTCTGGAGCAACAGTGTGG + Intronic
1083131938 11:60632978-60633000 TCACCTCTGGAGCATAAGAGTGG + Intergenic
1085451518 11:76636923-76636945 TCATCTCCAGATCACCAGTGAGG + Intergenic
1089564041 11:119361461-119361483 GCAACTCTGGAGCAACACTGGGG + Intronic
1089661702 11:119990317-119990339 CCATCCCTGGAGCTGCAGGGTGG + Intergenic
1090249121 11:125238940-125238962 TCATCTCTGGAATAGAAATGGGG + Intronic
1093425757 12:19027303-19027325 TCATCACTGCAGCAGCTGTGTGG - Intergenic
1094303365 12:28990946-28990968 TCATCTCTGGACCAGAAGCATGG + Intergenic
1094633398 12:32200071-32200093 TAATAGCTGGAGCACCAGTGTGG - Intronic
1096521963 12:52189553-52189575 TGAAATCTGGAGCAGCATTGTGG - Intronic
1097173039 12:57128185-57128207 TGCTCTCTGGAGCACCAGGGAGG + Intronic
1097333532 12:58357647-58357669 TGATCTATGGAGCAGGAGTGAGG + Intergenic
1098381976 12:69879253-69879275 GCATCGCAGGAGCAGCTGTGGGG - Intronic
1100855500 12:98753885-98753907 ACATCTCCCCAGCAGCAGTGTGG - Intronic
1103331186 12:120155156-120155178 TCCTGTCTGGAGCAGTAGCGGGG + Intronic
1103683807 12:122715590-122715612 GCATCTCTGGAGAAACAGTTGGG - Exonic
1104311862 12:127660518-127660540 GCATCTCTGGAGCATAAGGGAGG + Intergenic
1104789408 12:131472467-131472489 TCATCCCTAGAGCAGCCGTGCGG - Intergenic
1106677998 13:31982060-31982082 GCAGCTCTGGACCAGCAGTGGGG - Intergenic
1108275304 13:48803224-48803246 TCATGACTGGAGATGCAGTGAGG + Intergenic
1108325543 13:49327238-49327260 TCATCTCAGGAGAAGAAGTAGGG - Intronic
1109202837 13:59450003-59450025 TGATCTGTGGAGCACCAGGGTGG + Intergenic
1110220033 13:73062187-73062209 TCACCTCTGGAGCTGCGGTCTGG - Exonic
1113449214 13:110394687-110394709 CCACCTCTCCAGCAGCAGTGTGG - Intronic
1113866838 13:113532033-113532055 TCATCTGTGACGTAGCAGTGGGG + Intronic
1113884412 13:113650989-113651011 GAATCTCAGGAGCCGCAGTGTGG + Intronic
1118990092 14:70790159-70790181 TCATGCCCTGAGCAGCAGTGGGG + Intronic
1119484175 14:74977592-74977614 CCAATTCTGGAGCAGCAGGGAGG - Intergenic
1119758319 14:77134080-77134102 TCAGCGCTGCAGCTGCAGTGAGG + Intronic
1120829741 14:88987321-88987343 TCATTTGGGGAGCAGCAGAGGGG + Intergenic
1120866074 14:89296578-89296600 TCATCTCTGAAGCAGCAACTTGG + Intronic
1121442249 14:93956587-93956609 CCATCTCAGCAGGAGCAGTGGGG + Intronic
1122562671 14:102627772-102627794 GCAACTCTAGAGGAGCAGTGGGG - Intronic
1123786966 15:23684061-23684083 TCATTTCTGGAGTAGGACTGTGG - Intergenic
1125514924 15:40313188-40313210 TCATCGTGGGAGCAGCAATGTGG - Intergenic
1126557533 15:50005518-50005540 TCATATCTGGCCCAGGAGTGAGG + Intronic
1126831476 15:52611671-52611693 TCATCGCTGTAGCAGCAGTCTGG + Exonic
1128776545 15:70324699-70324721 TCATCCCTGGAGCCGGAGAGTGG - Intergenic
1129252755 15:74318039-74318061 TCCTCCCTGCAGCTGCAGTGTGG - Intronic
1129253224 15:74319897-74319919 TCATCTCTGCTGCAGCAGGAAGG + Intronic
1129442489 15:75591876-75591898 TCCTCTGTGCAGCAGCAGAGAGG + Intergenic
1129463866 15:75712986-75713008 TCCTCTCTGGGGCAGGGGTGAGG + Intergenic
1131234043 15:90681205-90681227 TCCTCTCTGGGGCAGCAGGGAGG + Intergenic
1132976198 16:2712307-2712329 TCATCTCTGAATCAGCAGAAGGG - Intergenic
1133582803 16:7162849-7162871 TCAAAGCTGGAGAAGCAGTGTGG + Intronic
1133710101 16:8393136-8393158 GCATCTGTGGAGCAGAAGAGGGG - Intergenic
1135408955 16:22218730-22218752 TCACCTCTTGAGCCTCAGTGGGG - Intronic
1137701658 16:50502180-50502202 GCAAGTCTGGAGCAGCAGGGAGG - Intergenic
1141344376 16:83231653-83231675 TCAACTCTGCAGCTGCAGGGTGG - Intronic
1141414016 16:83856039-83856061 TCATCCCTGGGGCAGCAGCCTGG - Intergenic
1144160620 17:12554040-12554062 TCATCCCTGCAGCAGCACAGGGG - Intergenic
1144743877 17:17600193-17600215 TCATCCATGGACCAGCAATGGGG - Intergenic
1144788332 17:17844130-17844152 GCAGCTCTGGAAGAGCAGTGTGG - Intronic
1145879458 17:28342854-28342876 AACTCTTTGGAGCAGCAGTGTGG + Intronic
1146944877 17:36866804-36866826 TCAGTTCTGGAGCAGCCCTGGGG + Intergenic
1147135768 17:38433492-38433514 CCATCACTGGAGGTGCAGTGAGG + Intronic
1147684746 17:42280396-42280418 TGATCTCTGGGGCAGGAGTGAGG - Intergenic
1148697130 17:49567432-49567454 TCATCCCTGGACCACCAGGGAGG - Intergenic
1151751880 17:76043758-76043780 TCAGCTGTGGAGGAGCTGTGAGG - Intronic
1152381123 17:79942718-79942740 TCATCTCTGGGGCATGATTGGGG - Intronic
1152668112 17:81583526-81583548 TCATCTCTGGGGCAGCCAGGTGG - Intronic
1153748697 18:8207847-8207869 TTATCCCTGGACCAGCAATGAGG + Intronic
1154083411 18:11279709-11279731 ACATCTCTGCAGCAGCTGAGAGG + Intergenic
1154206687 18:12343484-12343506 TCATCTGTGCTGCAGCAGTTCGG + Intronic
1155208457 18:23580706-23580728 TGCTCTCTGGAGAAGCAATGAGG - Intronic
1157395454 18:47337379-47337401 AGATCACTGGAGCTGCAGTGTGG - Intergenic
1157990498 18:52490241-52490263 TCATCTCTTATGCTGCAGTGAGG + Intronic
1158579168 18:58666474-58666496 ACATCTCTCGGGCAGCAATGTGG - Intergenic
1158726903 18:59981542-59981564 TCATCTCTGAAGTAGCAGGAGGG - Intergenic
1158836386 18:61334657-61334679 CCGCCTCTGGGGCAGCAGTGGGG + Intronic
1159023542 18:63162725-63162747 TCTTCCTTGGAGGAGCAGTGAGG - Intronic
1160071040 18:75628037-75628059 TCATGTCTGGAGCAGGAGGAAGG + Intergenic
1161159286 19:2752956-2752978 TCAGCTCAGCAGCAGCAGCGTGG - Intergenic
1161173352 19:2824422-2824444 TCATGTCAGCAGCAGCAGGGAGG - Intronic
1162087432 19:8257123-8257145 TCATCTCTGGGGCACCTGGGAGG - Intronic
1162215740 19:9132390-9132412 TCATCTCTGGAGCAAGACTCAGG + Intergenic
1162842076 19:13364025-13364047 TCAGCTCTGAACCAGCAGTGTGG - Intronic
1162932700 19:13965342-13965364 TCATCCCTGGAACAGGCGTGGGG + Intronic
1164666995 19:30046823-30046845 TCAAACCTGGAGCAGCAGGGGGG - Intergenic
1164907715 19:31981127-31981149 CCATCTCAGGAGCAGCTGAGAGG + Intergenic
1165240094 19:34459547-34459569 TCACCTCTGGAGCTGAAGCGAGG + Intronic
926908532 2:17828385-17828407 TCATCTTGGAAGCAGCGGTGAGG + Intergenic
926982668 2:18587474-18587496 TGATCTCTGTAGCAGAGGTGAGG - Intronic
928639897 2:33287238-33287260 TCATCTCTGTAGTACAAGTGTGG + Intronic
932815179 2:74855677-74855699 TAATCTCTGCAGTAGCATTGGGG + Intronic
935515970 2:104039395-104039417 TCAGCTCTGCAGCTGCATTGAGG - Intergenic
937248463 2:120509243-120509265 TCTTCTCTGGTCCTGCAGTGTGG - Intergenic
937352176 2:121173099-121173121 TCATGTCTGCAGCAGAAGTACGG + Intergenic
937352538 2:121175263-121175285 TCATTTCTGGGGCTGCACTGGGG - Intergenic
940469633 2:154079657-154079679 TCATCTCTGGAGCATAAGGAGGG - Intronic
941284671 2:163594813-163594835 TTATCTCTAGTGCAGCAGTGGGG - Intronic
941742132 2:169046539-169046561 TCATCTTGGGAGCAGCTGTGTGG + Intergenic
942161514 2:173193510-173193532 TCATCTCAGGAAAAGCAGAGGGG - Intronic
943291493 2:186078156-186078178 TCATCTCTGGGGAAGCAGGATGG - Intergenic
943562211 2:189477433-189477455 ACATCTCTGGTGCACCAGAGTGG + Intergenic
944531554 2:200672902-200672924 CCGTTTGTGGAGCAGCAGTGGGG + Intronic
947003158 2:225481201-225481223 TCATCTCTCAAGAAGCAGTCAGG + Intronic
947666791 2:231911051-231911073 CCAGCTCTGGGGCTGCAGTGGGG - Intergenic
948462601 2:238137593-238137615 GCATCTCAGGACCAGGAGTGGGG + Intergenic
948615445 2:239195485-239195507 TCATCTCTGCAGCTGGTGTGTGG - Intronic
948626831 2:239274753-239274775 TCTTTTCTGGAGCAGCTTTGGGG - Intronic
1168948503 20:1780787-1780809 TTTTCTCTAGAGCAGCTGTGTGG + Intergenic
1170675427 20:18475631-18475653 CCAGCTCTGGAGCAGGGGTGGGG - Intronic
1173527508 20:43744290-43744312 TCACCTCTGCAGAGGCAGTGGGG + Intergenic
1173945414 20:46946354-46946376 TCATTTCTTGAGCATCACTGCGG + Intronic
1174726180 20:52864542-52864564 TCACCTCTGCAGCAACAGTTGGG + Intergenic
1175624908 20:60482028-60482050 TCATGCCTGGTCCAGCAGTGAGG - Intergenic
1175626531 20:60492771-60492793 TGATCTATGTAGCAGCAGTCAGG + Intergenic
1175680600 20:60985641-60985663 TCATCTGTGCCACAGCAGTGGGG + Intergenic
1177342924 21:19827985-19828007 TCATTTCTGGAGTTGCAATGAGG - Intergenic
1178429529 21:32506801-32506823 ACCTCTCTCCAGCAGCAGTGAGG - Intronic
1180062440 21:45392657-45392679 CCATTTGTGGAGCAGCTGTGGGG - Intergenic
1182219953 22:28750475-28750497 TCATCTCTCAGGTAGCAGTGTGG - Intronic
1183036011 22:35141464-35141486 TCCTTTCTGGAGCAGGAGTCTGG - Intergenic
1184283457 22:43452412-43452434 GCAGCTGAGGAGCAGCAGTGGGG - Intronic
949777744 3:7651387-7651409 ACATCTCTGCAACAGCAGGGAGG - Intronic
952601315 3:35086876-35086898 TAATCTCTGTAACAGCAGAGAGG - Intergenic
954222803 3:49164970-49164992 TCATGTGTGGAGCTGGAGTGGGG + Intronic
954561393 3:51559680-51559702 TCATCTCTAGAACAGCAGCTGGG - Intronic
955982369 3:64539913-64539935 TCATCTCAGGAGCTACAGTAGGG - Intronic
957586378 3:82137717-82137739 TCATCACTACAGCAGTAGTGTGG - Intergenic
958047924 3:88307764-88307786 TCATCCCGGGACCAGCAGTCCGG - Intergenic
960947126 3:122974463-122974485 TCAGGGCTGGGGCAGCAGTGAGG - Intronic
960993987 3:123329249-123329271 ACATCTTGGAAGCAGCAGTGTGG - Intronic
963837485 3:150071673-150071695 TCATCTCTGAAGCTGCAGTTTGG - Intergenic
968291278 3:197541701-197541723 TCACCTCTGGGTCAGGAGTGAGG - Intronic
969411891 4:7033881-7033903 TCATCTCTGCAGCTGCTCTGCGG + Intergenic
969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG + Intronic
969824341 4:9745157-9745179 TCCTCTCTCCAGCAGCATTGAGG - Intergenic
970116308 4:12700063-12700085 GCATCTTGGGAACAGCAGTGAGG + Intergenic
971479674 4:27103166-27103188 GCATCTCTGGAGCAGCTCTGAGG - Intergenic
975174438 4:71271083-71271105 TAATCTATGGTGCAGCACTGAGG - Intronic
978603184 4:110449844-110449866 TCAACTCTGTTGAAGCAGTGTGG - Intronic
978901965 4:113962156-113962178 TCAACTCTGGGACAGCCGTGAGG + Intronic
980977229 4:139623139-139623161 AGATCCCTGGAGGAGCAGTGTGG + Intergenic
981499180 4:145430036-145430058 TCATCTCTGCTGTAGCAGTAGGG - Intergenic
982337250 4:154254249-154254271 TTGTCTCTGGAGAAGCAGTCAGG - Intronic
983564607 4:169136356-169136378 TGATCCGTGCAGCAGCAGTGGGG + Exonic
983965889 4:173809264-173809286 TAAACTCTGGAGCAGAATTGAGG - Intergenic
984278964 4:177644203-177644225 AGATTTGTGGAGCAGCAGTGAGG - Intergenic
985558707 5:570709-570731 TCATCTGCAGATCAGCAGTGCGG + Intergenic
986226877 5:5823844-5823866 TCATCTCTAGAGCTGCAATGGGG + Intergenic
986248063 5:6029155-6029177 TAACCCCAGGAGCAGCAGTGAGG + Intergenic
989076433 5:37568224-37568246 TTATCTCTGTAGCAGGTGTGTGG + Intronic
991503147 5:67297589-67297611 GCGTCTCTGGAGAAGCCGTGGGG + Intergenic
993120122 5:83764825-83764847 TCATCTCCAGTGCAACAGTGTGG - Intergenic
994502307 5:100595176-100595198 TTATCTCTGGAGTATCAGTTTGG + Intergenic
997164582 5:131646180-131646202 TCAAGTCTGGACCAACAGTGTGG + Intronic
997529742 5:134574599-134574621 TCAGCTCTGGGGCAGAAGTAGGG - Intronic
997964823 5:138348606-138348628 GCATGTCAGGAGCATCAGTGAGG + Exonic
998330219 5:141319351-141319373 TGACCTCAGCAGCAGCAGTGAGG - Exonic
999321588 5:150618626-150618648 TCCTCTCTGGAGCAGCTGGGTGG - Exonic
999333858 5:150698248-150698270 TCATCTCTGTAGCCCAAGTGAGG - Intronic
1000050934 5:157562407-157562429 TCTCCTCTGGAGCCTCAGTGTGG + Intronic
1001033353 5:168278806-168278828 TTCTCTCTGGGGCAGCAATGAGG - Intergenic
1002840699 6:902747-902769 TTTTCTCTGGAGCAGGGGTGAGG + Intergenic
1004553661 6:16674272-16674294 TCGCCTCTGTAGCAGCAGTATGG - Intronic
1006726846 6:36205385-36205407 TCATCTCTGGAGCAGCAGTGTGG - Intronic
1007756319 6:44101993-44102015 CCATCACTGGTGAAGCAGTGGGG - Intergenic
1010716420 6:79234724-79234746 TCCTCATTGGAGCAGCAGGGAGG - Intronic
1012648042 6:101714143-101714165 TCAGCTCTGGAGAAGCACTCTGG - Intronic
1013159818 6:107532158-107532180 TCATGTCTGGAGCATGAATGTGG + Intronic
1014365225 6:120531911-120531933 TCCTCACTGGAAAAGCAGTGGGG - Intergenic
1019322108 7:420462-420484 CCATCTTTAGAGCTGCAGTGAGG - Intergenic
1020380414 7:7538834-7538856 TCTACTCTAGATCAGCAGTGTGG - Intergenic
1021382962 7:19990845-19990867 TTATCCCTGGAGCATAAGTGAGG + Intergenic
1021655180 7:22867656-22867678 TCATCTCTGAGGCCACAGTGGGG - Intergenic
1021974229 7:25996250-25996272 TCATAACTCAAGCAGCAGTGGGG + Intergenic
1021989829 7:26130597-26130619 TCAGCCCAGGAGCAGCACTGTGG - Intergenic
1022989143 7:35690941-35690963 TCATCTCTGGAGTAGGGGTTAGG - Intronic
1023089660 7:36605861-36605883 TCTGCTCTCCAGCAGCAGTGAGG - Intronic
1023277857 7:38539652-38539674 TCATCTGCTGAGCAGCACTGGGG + Intronic
1025079456 7:55969207-55969229 AGGTCTCTGGAGCAGCAGTGTGG + Intronic
1025623139 7:63192694-63192716 TCAACTCTGTTGAAGCAGTGTGG - Intergenic
1032759469 7:134925865-134925887 ACATCTCTGGATCAGCCATGAGG - Intronic
1033147020 7:138879964-138879986 TCTTTTCTGGACCAGCAGTCTGG + Intronic
1033274007 7:139957484-139957506 TGCTCTCAGAAGCAGCAGTGCGG + Intronic
1034696246 7:153056484-153056506 TGATTTCTGGAGCATCTGTGAGG - Intergenic
1035254116 7:157615261-157615283 CCCTCTCTGGAGCAGAAGTGTGG - Intronic
1035338291 7:158143994-158144016 CCTTCTCTGGAGCTGCAGTGGGG - Intronic
1037034013 8:14143790-14143812 ACATCTCTGCAGCAGTAGTAAGG + Intronic
1037270797 8:17128132-17128154 TCAGCTTTGAAACAGCAGTGAGG + Intergenic
1039342351 8:36664874-36664896 GCATCCCTGGGGAAGCAGTGAGG + Intergenic
1039520965 8:38171318-38171340 ACATGTCTGGTGCATCAGTGGGG - Intronic
1039804773 8:40988583-40988605 TCGGGTCTTGAGCAGCAGTGTGG - Intergenic
1040981492 8:53250698-53250720 CCGCCACTGGAGCAGCAGTGGGG - Intronic
1041336439 8:56789625-56789647 TCAGCTCTAGAGCAGTGGTGTGG + Intergenic
1045545075 8:103121423-103121445 TCAGCTCTGAGGCAGCTGTGGGG + Intergenic
1046095332 8:109552314-109552336 TCATCTCTGGATGATCACTGGGG + Intronic
1046661639 8:116953921-116953943 GCATCTCTCTGGCAGCAGTGTGG + Intronic
1048328975 8:133459508-133459530 CCAGCTCTAGGGCAGCAGTGGGG + Exonic
1048412330 8:134188178-134188200 GCATCTTTGGAGAAGCCGTGTGG - Intergenic
1048934443 8:139343447-139343469 TCATCTCTGCAGCAGGGTTGGGG + Intergenic
1049353734 8:142177620-142177642 TGAGCTCTGGAGCGGAAGTGGGG - Intergenic
1049466640 8:142753992-142754014 GCACCTCTGAAGCTGCAGTGAGG - Intergenic
1050580699 9:7052729-7052751 TCATCCCTGAAGCAGCAGCAAGG + Intronic
1051244298 9:15093488-15093510 ACATCTCTGGAGGAGGAGGGAGG + Intergenic
1051679001 9:19588119-19588141 ACATCTCTGAAGCAGTAATGTGG + Intronic
1051947904 9:22594286-22594308 TCATATCATGAGCAGCATTGTGG - Intergenic
1052434025 9:28403143-28403165 GCAAATCTGGAGCAGCAGAGGGG - Intronic
1055791694 9:79929283-79929305 TAATCTCTGGAGCGGGAGTGAGG + Intergenic
1055809454 9:80135140-80135162 TCATCTCTGGAGAAGTAATGTGG - Intergenic
1056137879 9:83647251-83647273 CCAGCTGTGGAGCAGCTGTGGGG - Intergenic
1057430016 9:94985127-94985149 TCATCACAGCAGCGGCAGTGAGG + Intronic
1057731210 9:97610226-97610248 TCCTCTCTAAAGCAGCTGTGGGG - Intronic
1058586428 9:106511507-106511529 CCATTTGAGGAGCAGCAGTGAGG + Intergenic
1059844053 9:118251255-118251277 TGGTCTCAGGAACAGCAGTGGGG - Intergenic
1060023094 9:120149144-120149166 TCTTCTCAGGGGCAGCAGTGGGG + Intergenic
1060090977 9:120743208-120743230 TCATCCCTGGACCAACAGCGAGG + Intergenic
1060718516 9:125957067-125957089 CCATCTCAGTTGCAGCAGTGTGG + Intronic
1061638091 9:131928225-131928247 TCCTCTCTGGAGGAGCAGGGAGG - Intronic
1061776757 9:132970782-132970804 TCATCTCTGCAGCCTCAGAGTGG + Intronic
1062518275 9:136946753-136946775 TCGTCTCTGCTGCAGAAGTGAGG + Exonic
1186667245 X:11729980-11730002 TAATGTTTGGAGCACCAGTGAGG + Intergenic
1189169325 X:38893788-38893810 TCATGGCTGGAGCAGAAGAGGGG + Intergenic
1192932850 X:75826026-75826048 TCATTGCTGGAGCAGCTGGGAGG + Intergenic
1195615424 X:106908248-106908270 AAATCTCTGGGGCAGCTGTGAGG - Intronic
1196309179 X:114141625-114141647 GCATCTCTTGAGAAGGAGTGTGG + Intergenic
1197177349 X:123500139-123500161 TCAGCAATGGGGCAGCAGTGCGG + Intergenic
1197301957 X:124791907-124791929 TCAACTCTGGAGACACAGTGTGG - Intronic
1197774878 X:130112072-130112094 TCATCTCAGGCGCAGGACTGGGG + Intergenic
1199529597 X:148831570-148831592 CCTTATCTGCAGCAGCAGTGGGG - Intronic