ID: 1006727473

View in Genome Browser
Species Human (GRCh38)
Location 6:36210400-36210422
Sequence ACCTGGGAGGGGCCATCCTA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006727464_1006727473 0 Left 1006727464 6:36210377-36210399 CCGAGCAGCTGTCCGCCTGCGGG 0: 1
1: 0
2: 2
3: 6
4: 134
Right 1006727473 6:36210400-36210422 ACCTGGGAGGGGCCATCCTACGG 0: 1
1: 0
2: 1
3: 12
4: 134
1006727462_1006727473 3 Left 1006727462 6:36210374-36210396 CCACCGAGCAGCTGTCCGCCTGC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1006727473 6:36210400-36210422 ACCTGGGAGGGGCCATCCTACGG 0: 1
1: 0
2: 1
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006727473 Original CRISPR ACCTGGGAGGGGCCATCCTA CGG Exonic