ID: 1006732567

View in Genome Browser
Species Human (GRCh38)
Location 6:36247211-36247233
Sequence CAGTAGTCTGTGGGGCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006732567_1006732579 30 Left 1006732567 6:36247211-36247233 CCTCAGGGCCCCACAGACTACTG 0: 1
1: 0
2: 3
3: 20
4: 238
Right 1006732579 6:36247264-36247286 CCTTTCCCAGCCTAAATTCCAGG 0: 1
1: 0
2: 1
3: 20
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006732567 Original CRISPR CAGTAGTCTGTGGGGCCCTG AGG (reversed) Intronic
900124883 1:1064857-1064879 GTGTGGTCTGCGGGGCCCTGGGG + Intergenic
900124911 1:1064917-1064939 GTGTGGTCTGCGGGGCCCTGGGG + Intergenic
900124969 1:1065037-1065059 GTGTGGTCTGCGGGGCCCTGGGG + Intergenic
900124997 1:1065097-1065119 GTGTGGTCTGCGGGGCCCTGGGG + Intergenic
900649619 1:3724383-3724405 CAGGAGTCTGGGGTGTCCTGGGG - Intronic
902892882 1:19457306-19457328 CTGTAGTCTCTGGGGCCCACTGG - Intronic
904803921 1:33117931-33117953 CAGCAGCCTGTGGGGCCCGGCGG + Exonic
904836634 1:33341958-33341980 CAGCAGGCTGTGGCTCCCTGAGG + Intronic
905000599 1:34665303-34665325 TACTAGTCTTTGGGGCTCTGAGG + Intergenic
906310171 1:44748339-44748361 AAGTATTCTGTGAGTCCCTGAGG - Intronic
906682339 1:47737361-47737383 CAGTAGACTGTGATGCTCTGTGG + Intergenic
909662685 1:78101276-78101298 AAGTTGGCTGTGGGGCTCTGAGG + Intronic
910024369 1:82631212-82631234 CAGTAGGCTGGGGGTCCCTGTGG - Intergenic
912492144 1:110068320-110068342 AAGTAGGCTGTGCGGCCCTGGGG + Intronic
912681715 1:111733331-111733353 CAGTGGTCCCTGGGGTCCTGAGG + Intronic
912734184 1:112135474-112135496 CAGGAGTCTATGGAGCCCAGAGG + Intergenic
913063807 1:115231419-115231441 CACTAGCCTTTGGGGACCTGTGG + Intergenic
913971860 1:143422546-143422568 CAGTCCTCTCTGGGGTCCTGGGG + Intergenic
914066239 1:144248159-144248181 CAGTCCTCTCTGGGGTCCTGGGG + Intergenic
914112914 1:144718195-144718217 CAGTCCTCTCTGGGGTCCTGGGG - Intergenic
916679299 1:167089564-167089586 CAGTGTTCTGTGGGGACCTATGG - Intronic
916910517 1:169341175-169341197 CACTGCTCTGTGTGGCCCTGGGG + Intronic
917966362 1:180181465-180181487 CAGTAGTCAGAGGGGCCCTTTGG - Intronic
918628061 1:186680828-186680850 CAGGAATCTGAGCGGCCCTGAGG + Intergenic
919791937 1:201297340-201297362 CTGAGGTCTGTGGGGCTCTGAGG - Intronic
920720186 1:208379942-208379964 CAGAAGTCAGTGGAGCCTTGTGG + Intergenic
921339933 1:214124628-214124650 CATGAGTCTGTGGGGGCCGGGGG + Intergenic
922772549 1:228194683-228194705 CAGCAGCCTGTGGGTCCCTGGGG - Intergenic
1062961608 10:1576847-1576869 CAGTCTGCTGTGTGGCCCTGGGG + Intronic
1063449325 10:6140825-6140847 CTGTAGCCCCTGGGGCCCTGGGG + Intergenic
1064408355 10:15084245-15084267 CAGCAGTCCGTGAGGCCCCGTGG - Intronic
1066720040 10:38328262-38328284 CTGTGTTCTGTGGAGCCCTGCGG + Intergenic
1067466387 10:46502110-46502132 CAGCACTCTCTGGGACCCTGTGG - Intergenic
1067563131 10:47317823-47317845 CAGGAATCTGTGGTGCCCTCTGG + Intergenic
1067620801 10:47882495-47882517 CAGCACTCTCTGGGACCCTGTGG + Intergenic
1069005469 10:63313112-63313134 CAGTGGACTTTGGGGCCTTGCGG - Intronic
1069247144 10:66220434-66220456 CAGAACTCTGTGTGGCCCCGTGG + Intronic
1069563171 10:69445619-69445641 CAGTTGTCTGGGGGGCTCAGAGG - Intergenic
1072660410 10:97360364-97360386 CTGGAGTCTAAGGGGCCCTGGGG - Intronic
1074113140 10:110436837-110436859 TAGAAGTCTTTGGGGCTCTGGGG - Intergenic
1076783387 10:132736814-132736836 CAGGAGTCTGTGGGGCTGTGGGG - Intronic
1077339848 11:2021391-2021413 CAGTGGTCTGGGGTGGCCTGAGG + Intergenic
1080360043 11:31502509-31502531 CAGGAGCCTGTGGGACCCTTCGG + Intronic
1085701771 11:78752188-78752210 CAGCACTGTGCGGGGCCCTGGGG + Intronic
1088683500 11:112265463-112265485 CACTAGTCTGAGGAGCCCTGGGG + Intronic
1090412900 11:126521181-126521203 CAGCAGTGTCTGGAGCCCTGTGG + Intronic
1090676858 11:129007012-129007034 CAGTACTCCCTGTGGCCCTGTGG - Intronic
1202822833 11_KI270721v1_random:76580-76602 CAGTGGTCTGGGGTGGCCTGAGG + Intergenic
1091600312 12:1914025-1914047 CAGTGGCCTGTGGGGGCCCGGGG + Intronic
1096604337 12:52754009-52754031 CAGTAGTCTGTACAGCCTTGGGG - Intergenic
1096676584 12:53229647-53229669 CAGGAGTTTGGGGGCCCCTGAGG + Intronic
1103976533 12:124706218-124706240 CAGAGGTCTGAGGAGCCCTGAGG - Intergenic
1106633245 13:31499210-31499232 CAGTAGAAAGTGGGTCCCTGAGG + Intergenic
1107722865 13:43267316-43267338 CAGGAGTCAGTGGGGCCTGGAGG + Intronic
1107986585 13:45781624-45781646 CAGTAATCGCTGGGCCCCTGGGG - Exonic
1112434281 13:99380433-99380455 CAGTTGTCTGTAGGGCTCTTTGG - Intronic
1112595652 13:100804738-100804760 CAGCAGGCTGTGGGTCCCAGGGG - Intergenic
1113800744 13:113085226-113085248 CAGGTGTCTGTGCCGCCCTGGGG + Intronic
1113860025 13:113475910-113475932 CAGTAGGCGGTGGGGCACAGTGG - Intronic
1114814359 14:25939229-25939251 CAGTAGACTGTGAGGTCCTTGGG - Intergenic
1115433846 14:33351206-33351228 CAGCAGTCTGTTGTGCCCTTTGG + Intronic
1115883423 14:37945654-37945676 CGGTAGTCTCGGGTGCCCTGGGG + Intronic
1116076140 14:40113246-40113268 AAGTTGTCTGTAGGCCCCTGAGG - Intergenic
1118869357 14:69728136-69728158 CAGTTGTGAGTGGGGCCGTGAGG + Intronic
1124683149 15:31754868-31754890 CTGTGGTCTGTGGACCCCTGGGG - Intronic
1124840360 15:33235733-33235755 CACTAGTCTGGGGTGACCTGGGG - Intergenic
1129257022 15:74339409-74339431 CAGCAGCCTGGGGGGACCTGGGG + Intronic
1129711511 15:77822617-77822639 CAGTAGTAGCTGGGGGCCTGGGG + Intergenic
1129740841 15:77988837-77988859 CAGTGGGTGGTGGGGCCCTGGGG + Intronic
1129844883 15:78763703-78763725 CAGTGGGTGGTGGGGCCCTGGGG - Exonic
1129920547 15:79315885-79315907 CAGTTGGCTATGGGGCACTGTGG + Intronic
1130256942 15:82330137-82330159 CAGTGGGTGGTGGGGCCCTGGGG + Intergenic
1130598006 15:85259851-85259873 CAGTGGGTGGTGGGGCCCTGGGG - Intergenic
1131097579 15:89666077-89666099 CAGTAGTTTGGGGGGCACCGGGG + Intronic
1131546996 15:93323997-93324019 TAGTAGTCTGTGGTGCCCAGTGG + Intergenic
1132484440 16:183156-183178 CAGGAGGCTCAGGGGCCCTGAGG + Intergenic
1133257578 16:4526783-4526805 CAGTGGTGTTTGGGGCCATGGGG - Intronic
1134857338 16:17531303-17531325 CAGTAGACTTTGGGGACTTGGGG - Intergenic
1137581239 16:49634763-49634785 CTGGAGTCTGTGTGGCCCTTGGG - Intronic
1137934025 16:52616802-52616824 CAGTGGGCTGTGTGGTCCTGCGG + Intergenic
1140043781 16:71426203-71426225 CAAGAGGCGGTGGGGCCCTGCGG - Intergenic
1140522524 16:75594047-75594069 CAGCAGGCTGTGGGGCCTAGGGG + Intergenic
1141434658 16:83993129-83993151 CTCTAGGCTGTGGGTCCCTGAGG + Intronic
1141597467 16:85106235-85106257 CACTAGTGTCCGGGGCCCTGTGG + Intronic
1141685152 16:85565882-85565904 CAGTCTTCTGGTGGGCCCTGTGG + Intergenic
1141720513 16:85752767-85752789 CAGGAGTCAGCGGGTCCCTGGGG + Intergenic
1143147938 17:4788918-4788940 CAGAAGCCCGTGGTGCCCTGAGG - Intergenic
1143396245 17:6600235-6600257 CAGTAGTGTGTGGTGGTCTGGGG + Intronic
1143948854 17:10617318-10617340 CAGGACTCTCTGGGGACCTGCGG + Intergenic
1145011021 17:19367971-19367993 GAGCACTCTGGGGGGCCCTGAGG + Intronic
1146761508 17:35482844-35482866 CTGTAGACTGTGGGGACTTGTGG + Intronic
1147421250 17:40323146-40323168 CAGAAGTCTGGGGGGTCCTGGGG - Intronic
1148433313 17:47661001-47661023 CAGGGCTGTGTGGGGCCCTGAGG + Intronic
1148567825 17:48644180-48644202 GAGTAGTTTCTGGGGCCCTTGGG + Intergenic
1151889624 17:76944447-76944469 CAGAAGTGTGTGGGGCTCAGAGG + Intronic
1152557162 17:81059130-81059152 CAGCAGCCTGTGGGGGCGTGGGG - Intronic
1152936960 17:83144704-83144726 CAGAACTCTGTGGGGGCCAGAGG + Intergenic
1153104611 18:1511884-1511906 CAGGAGTCTGTGGGGGAATGTGG + Intergenic
1153706362 18:7749528-7749550 AAGTATTCCTTGGGGCCCTGTGG + Intronic
1158851183 18:61496569-61496591 CAGGAGTCAGGGGCGCCCTGTGG + Intronic
1159989227 18:74882949-74882971 CAGCAGTCTGTTGTTCCCTGGGG - Intronic
1161676097 19:5650762-5650784 CAGTATTGTGACGGGCCCTGTGG + Intronic
1162704544 19:12545565-12545587 CAGAAGTGTGGGTGGCCCTGCGG - Intronic
1162805942 19:13138131-13138153 CAGTAGTCTGTGGGGCAGGGTGG - Exonic
1163639358 19:18452608-18452630 CAGCAGTCTGTTGTCCCCTGAGG - Intronic
1163927062 19:20356009-20356031 CAGCAGCTTGGGGGGCCCTGAGG + Intergenic
1165080465 19:33303363-33303385 CGCTAGTCTGGGGGGCCCCGCGG - Intergenic
1165264192 19:34646731-34646753 CAGGAGTGTGGGGAGCCCTGAGG - Intronic
1166214840 19:41328070-41328092 CTGCAATCTGTGGGGCCCTGTGG + Intronic
1166390635 19:42407146-42407168 CAGGTGGCTGTGGGGGCCTGAGG + Intronic
1167603351 19:50467129-50467151 CAGTTCTCTGTAGGGCCTTGGGG - Intronic
1167698606 19:51029381-51029403 TGGGGGTCTGTGGGGCCCTGTGG - Exonic
1168187273 19:54708311-54708333 CAGTAGCCACTGGAGCCCTGAGG - Intergenic
926115517 2:10210582-10210604 CTGCTGTCTATGGGGCCCTGGGG - Exonic
926579059 2:14614898-14614920 GTCAAGTCTGTGGGGCCCTGAGG - Intergenic
928094893 2:28398477-28398499 CACTAGTGTGTGGGCCCCTTTGG - Intronic
930651047 2:53965536-53965558 CAGTATGTTGTGGAGCCCTGAGG + Intronic
931668588 2:64627293-64627315 AAGAAGTCTGTGAGGCCCTAAGG + Intergenic
931824997 2:65991241-65991263 CATCAGTCTGTGGGGCCCTGTGG + Intergenic
931835195 2:66091784-66091806 CAGTGGACTTTGGGGCCTTGGGG + Intergenic
932468946 2:71941479-71941501 CAATAGGCTGTGTGGCTCTGGGG - Intergenic
932498607 2:72160328-72160350 TAGTACACTGTGGGTCCCTGTGG + Intergenic
934568020 2:95351285-95351307 CAGCAGCCAGTGGGACCCTGCGG - Intronic
935268482 2:101414145-101414167 CACCCGTGTGTGGGGCCCTGTGG - Intronic
935366463 2:102296637-102296659 CACTAGGCTGAGGGGCCTTGGGG + Intergenic
936250669 2:110866150-110866172 CAGCAGGATGTGGGGGCCTGGGG + Intronic
936852035 2:116911784-116911806 CAGTAGTCTATGTGGCTCTGGGG - Intergenic
938392123 2:130914873-130914895 CAGTAGTTTCTGGGGCACTATGG - Intronic
940052950 2:149483112-149483134 CAGTTGTCTGTGGACCCCAGGGG + Intergenic
942001488 2:171652609-171652631 CAGTAGTCTCTGAGGACCTTGGG - Intergenic
942232984 2:173877105-173877127 CAATGGTCTGTGAGGCCCAGCGG - Intergenic
942750113 2:179277321-179277343 CAGTACTCTTTGTGGGCCTGAGG + Intergenic
943254510 2:185576747-185576769 CAGTGGTCTTTGGGGACTTGAGG - Intergenic
943741232 2:191411645-191411667 CACTGGTCTGTGGTGCCCTTTGG + Intronic
946047230 2:216831340-216831362 GAGTTGTGTGTGGTGCCCTGTGG + Intergenic
947983228 2:234427344-234427366 AAGCAGGCTCTGGGGCCCTGGGG + Intergenic
948795049 2:240398363-240398385 CTGGCGTCAGTGGGGCCCTGCGG - Intergenic
1169592549 20:7161671-7161693 CAGTAATCTGTGAGGACTTGGGG - Intergenic
1169682269 20:8228621-8228643 CAGTATTCTGTGGGAGGCTGAGG - Intronic
1169894466 20:10488078-10488100 CAGAACTCTGTTGGGACCTGGGG - Intronic
1171180149 20:23085696-23085718 AAGTGGTCTGAGGGCCCCTGTGG - Exonic
1172095433 20:32457850-32457872 GAGTAGGCTGTGGGGTCCCGGGG - Intronic
1172187772 20:33041954-33041976 CAGTAATCTGTGGGGGAGTGGGG - Exonic
1175533935 20:59694253-59694275 CAATGGTCTGTGGATCCCTGAGG - Intronic
1176027730 20:62994474-62994496 CAGTTATCTGTCGGGCACTGTGG - Intergenic
1176973328 21:15290332-15290354 CCGAAGTCTGGGGGGGCCTGAGG + Intergenic
1177953093 21:27563321-27563343 CAGTAGTCTTTTAAGCCCTGTGG - Intergenic
1178507202 21:33171706-33171728 TAGTAGTCTGAGGGCCCCTGGGG + Intergenic
1179074204 21:38103194-38103216 CAGTAGCCAGTGGATCCCTGAGG - Intronic
1179188833 21:39106581-39106603 CAGGAGCCTGTGGGGCTCAGAGG - Intergenic
1179717167 21:43295151-43295173 AAGTGGTGTGTGGGTCCCTGGGG - Intergenic
1180092900 21:45542036-45542058 CTGGGGTCTGGGGGGCCCTGGGG - Intronic
1180092925 21:45542096-45542118 CTGGGGTCTGGGGGGCCCTGGGG - Intronic
1182076500 22:27498997-27499019 CAGAAGCCTGTGGAGCCCTGGGG + Intergenic
1182770828 22:32795069-32795091 CTGTGGACCGTGGGGCCCTGGGG + Intronic
1183647520 22:39134962-39134984 GAGTGCTCTGTGGGGCCCAGAGG - Intronic
1184852860 22:47130687-47130709 GAGCAGTCTGTGGGACCCTGCGG + Intronic
950426581 3:12927748-12927770 GAGTAGGCCGTGGGCCCCTGCGG + Intronic
950876880 3:16283667-16283689 TAGTAGTCTGTGAGTCCTTGAGG + Intronic
952103492 3:30042438-30042460 TTGTAGTCTGTGGTGCCCTCTGG - Intergenic
953037284 3:39224125-39224147 CTGGATTCTGTGGGGCCTTGTGG - Intergenic
953096597 3:39782892-39782914 CAAGAGTCTGTAGGGCCTTGAGG - Intergenic
954373613 3:50183118-50183140 CAGGAGTGGGTGGGGCCCAGGGG + Intronic
957223437 3:77413094-77413116 CAGTACTCTTTTGGGCCCTGGGG + Intronic
957449896 3:80366288-80366310 CAGGAGGCTGTTGGGCACTGGGG + Intergenic
958023990 3:88028688-88028710 CAGAACTCTGTGTGGCCCTGCGG - Intergenic
960358215 3:116679022-116679044 CAGAGCTCTGTGAGGCCCTGCGG - Intronic
964190447 3:153994376-153994398 CAATGGACTGTGGGGACCTGGGG + Intergenic
965223305 3:165955199-165955221 CAGTGGTCTTTGGGGACTTGGGG + Intergenic
968540377 4:1165311-1165333 CAGAAGTCTCTGGGGCCCCAGGG - Intergenic
968812843 4:2807880-2807902 CAGGAGGCTGTGGGCACCTGCGG + Intronic
968863633 4:3193137-3193159 CAGGATTCTGTGGCGCCGTGCGG - Intronic
969254556 4:5993167-5993189 CAGGAGTCTGTGGGCCGCAGAGG - Intergenic
969637258 4:8376630-8376652 CAGGAGTGTGCGGGGCCCAGCGG - Intronic
971058616 4:22941577-22941599 CAGTTCTCTTTGGGGACCTGGGG - Intergenic
974396124 4:61337263-61337285 CTCTTGTCTGTGGGGCCTTGAGG + Intronic
975022225 4:69503259-69503281 GGGTAGTCTTTGGTGCCCTGGGG + Intronic
975081037 4:70280854-70280876 CAGTATTCTTTGTGGGCCTGTGG + Intergenic
977669870 4:99683410-99683432 CAGTAGTCTGTGGGTCTAAGAGG - Intergenic
978726124 4:111971767-111971789 CAGTGGACTGTGGGGACTTGGGG - Intergenic
979168693 4:117571394-117571416 CAGTAGTCTGTGGTATGCTGTGG - Intergenic
979540345 4:121873782-121873804 TAGTAGTCTGTGGGGCCCCGAGG - Intergenic
982090997 4:151879840-151879862 CAGAAGTCTCTGGGGCCCTGTGG + Intergenic
986226838 5:5823648-5823670 AAGCAGGCTGTGGTGCCCTGGGG - Intergenic
987108774 5:14665159-14665181 CAGAATTGTGAGGGGCCCTGGGG - Intronic
990594075 5:57295621-57295643 CAGTACTCTGGGAGGCCGTGGGG + Intergenic
991682081 5:69149842-69149864 CAGTACTCTCTGTGGGCCTGTGG - Intergenic
993415310 5:87621713-87621735 CAGCAGTGTGTGGGACCCTGAGG + Intergenic
993863019 5:93159103-93159125 CAGCAGACTGTGGGGATCTGAGG + Intergenic
995121162 5:108536452-108536474 CAGAACTCTTTGCGGCCCTGCGG - Intergenic
995526021 5:113051191-113051213 CTGTCTTCCGTGGGGCCCTGAGG - Intronic
996263574 5:121505895-121505917 CAGTGGACTTTGGGGCCTTGGGG + Intergenic
996591470 5:125152797-125152819 CAGTAGGGTGAGGAGCCCTGGGG + Intergenic
997720664 5:136076288-136076310 CAGTCGATTGTGGGGCCATGAGG + Intergenic
1001656740 5:173356487-173356509 CTTCTGTCTGTGGGGCCCTGTGG + Intergenic
1001766165 5:174248881-174248903 CAGCAGTTTGTGGGGCCGAGGGG + Intergenic
1002081776 5:176741688-176741710 CAGTCTTCTGTGAGGCCCCGGGG - Intergenic
1002200307 5:177524271-177524293 CAGGAGTCTGTGCAGCCCTCAGG - Exonic
1002989440 6:2224375-2224397 CAGAAGTCATTGTGGCCCTGTGG - Intronic
1005870703 6:29972447-29972469 ATGAAGACTGTGGGGCCCTGGGG + Intergenic
1006641474 6:35491780-35491802 GAGCAGGCTTTGGGGCCCTGGGG + Intronic
1006732567 6:36247211-36247233 CAGTAGTCTGTGGGGCCCTGAGG - Intronic
1007642695 6:43355303-43355325 CTCTAGTCTGTGGGGATCTGAGG + Exonic
1009835926 6:69001706-69001728 CAGTACACTGTGAGGACCTGTGG - Intronic
1012524775 6:100164291-100164313 CAGCAACCTGTGGGTCCCTGTGG - Intergenic
1012974483 6:105765422-105765444 CAGTAGGCAGTTGGGCCCTAGGG - Intergenic
1013177370 6:107689348-107689370 CTGTGTTCTGAGGGGCCCTGAGG - Intergenic
1014719531 6:124899022-124899044 GTGTGGTCTATGGGGCCCTGGGG + Intergenic
1016813564 6:148283319-148283341 CAGGAGTCTGGGGGCCTCTGGGG - Intronic
1016902487 6:149116141-149116163 CCATACTCTGTGAGGCCCTGAGG - Intergenic
1017079520 6:150654372-150654394 CAGTAATCCGTGGTGCCTTGTGG + Intronic
1018238154 6:161745953-161745975 CAGCTCTCTGTGGGGGCCTGTGG + Intronic
1019088038 6:169500479-169500501 CAGAAGTTAGTGTGGCCCTGAGG - Intronic
1019169676 6:170125838-170125860 CAGGAGTCTGTAGAGCCCTGGGG + Intergenic
1019716234 7:2540753-2540775 CAGGGGTGTGTGGGGCCGTGGGG - Intronic
1019735986 7:2649907-2649929 CAGAAGTCGCTGGAGCCCTGAGG - Exonic
1020915450 7:14186845-14186867 CAGTAGACTTTGGGGACTTGGGG + Intronic
1021876208 7:25051926-25051948 CAGTAGACTCTGGGGACTTGGGG + Intergenic
1022216746 7:28270546-28270568 CAGTGGTATTTGGGTCCCTGAGG + Intergenic
1022459252 7:30588401-30588423 CAATAGTCAGTGAGGACCTGTGG - Intergenic
1024257101 7:47547366-47547388 CAGCACTCAGTGGAGCCCTGGGG + Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1028378652 7:90174680-90174702 CAGTAGAATGTGTGGCCCGGAGG - Intronic
1031997356 7:128241359-128241381 CAGAGTTGTGTGGGGCCCTGTGG - Intronic
1032482073 7:132255208-132255230 CAGGAGTCTGTGGGTCACAGGGG + Intronic
1032857947 7:135851975-135851997 CAATAGACTGTGGGGACTTGCGG - Intergenic
1034993861 7:155565982-155566004 CAATAGGGTGTGGGCCCCTGAGG + Intergenic
1035596570 8:862784-862806 CACCAGACTTTGGGGCCCTGGGG - Intergenic
1038008749 8:23457418-23457440 CAGGCGGCTGTGGGGGCCTGGGG + Intronic
1038333660 8:26629425-26629447 CAGTAGCATTTGAGGCCCTGAGG + Intronic
1038715215 8:29985318-29985340 CAGCAGCCTGTGCTGCCCTGTGG + Intergenic
1039380939 8:37084723-37084745 CAGTAAACTGTGGGTCCCAGTGG + Intergenic
1043315600 8:78917756-78917778 CAGTAGACTTTGGGGACTTGGGG - Intergenic
1045096775 8:98806161-98806183 CAGTAGTGTGTGAGGTTCTGTGG - Intronic
1045272610 8:100674792-100674814 TAGGAGTCTGGGGAGCCCTGAGG - Intergenic
1046225439 8:111272844-111272866 CAGCAGACTTTGGGGACCTGGGG - Intergenic
1047658773 8:127009411-127009433 CACCAGTGTGTGGGGGCCTGTGG - Intergenic
1047679801 8:127242994-127243016 AAGAAGACTGTGTGGCCCTGCGG + Intergenic
1048034611 8:130665693-130665715 CATTAGTCTGTGTGTCCTTGGGG + Intergenic
1048635470 8:136290764-136290786 CAGTAGTGGGAGGGGACCTGGGG + Intergenic
1049409130 8:142464682-142464704 AAGTCGTCGGTGGGGCCCGGCGG - Exonic
1049700181 8:144007346-144007368 GATTAGTCTGGAGGGCCCTGGGG - Intronic
1051235295 9:14993055-14993077 CAGTAGTCTGGGGGGGTCTCTGG + Intergenic
1056308741 9:85319097-85319119 CAGTGGCCTTTCGGGCCCTGAGG - Intergenic
1056761858 9:89421109-89421131 CAGGAGTCTATGTGGACCTGGGG - Intronic
1057272167 9:93657496-93657518 CAGTAGTCAGGCTGGCCCTGTGG - Intronic
1059285577 9:113169025-113169047 CAGTAGTGTGGCGGGCCCTGTGG - Intronic
1059389022 9:113987209-113987231 CAGAAGGATGTGGGGCCCTTAGG + Intronic
1059429106 9:114239550-114239572 CTGTGCTCTGTGGGGCCCTAAGG + Intronic
1060972060 9:127743984-127744006 CAGTGGTCTCTGGCTCCCTGAGG - Intronic
1061167710 9:128933776-128933798 AAATAGTCTGTGCTGCCCTGTGG - Exonic
1062233724 9:135498090-135498112 CAGGAGTCTGTGGGCCATTGGGG - Intronic
1062464188 9:136673950-136673972 CAGTGGCCTGTGGGGAGCTGGGG + Intronic
1186220123 X:7341603-7341625 CAGTAGTCTGTTGGTCCTTCAGG + Intronic
1187767062 X:22654263-22654285 CAGTAGTTTGGGGACCCCTGGGG + Intergenic
1189132845 X:38518134-38518156 GAGTGTTCTGTGGGGTCCTGGGG + Intronic
1192266564 X:69542672-69542694 CAGAATTCTGTGGTGCCCTCGGG + Intergenic
1192947155 X:75976650-75976672 CAGTGGACTGTGGGGACTTGAGG - Intergenic
1195396191 X:104412685-104412707 CAGTACTCTTTGTGGACCTGTGG + Intergenic
1197261559 X:124324984-124325006 CAGTAGACTTTGGGGACTTGAGG + Intronic
1197762220 X:130036030-130036052 CAGTCCTCTCTGGGGCACTGGGG - Intronic
1197810790 X:130441464-130441486 CAGTACTCCCTGGGGACCTGTGG - Intergenic