ID: 1006732819

View in Genome Browser
Species Human (GRCh38)
Location 6:36248954-36248976
Sequence CTAGAGAGGCCCAATGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006732819 Original CRISPR CTAGAGAGGCCCAATGGGGA AGG Intronic
900242376 1:1623300-1623322 GCAGAGAGGCCCAACGGGGCAGG - Intronic
900265686 1:1755954-1755976 CAAGGGAGGCCCAGAGGGGATGG + Intronic
900646973 1:3713384-3713406 AAAGAGAGGCCCACAGGGGAGGG + Intronic
901006357 1:6173546-6173568 AGAGAGAGGCTCAGTGGGGAGGG - Intronic
901443839 1:9294953-9294975 CTAGAGAGGCCCAGAGAGGGCGG + Intronic
902652387 1:17845133-17845155 CAAGAGAGGTCACATGGGGAAGG - Intergenic
902716496 1:18276355-18276377 CTAGAGAGGCCACCTGGAGAAGG - Intronic
902742090 1:18445799-18445821 CTAGAGGGGTCCAGTGGGGGTGG + Intergenic
905323288 1:37132570-37132592 CCAGGGATGGCCAATGGGGATGG - Intergenic
905391124 1:37635914-37635936 CTAGAGTGTCCCAATGGCCAGGG + Intergenic
906786100 1:48617516-48617538 TTAGAGAGTCCCTTTGGGGAAGG - Intronic
907496743 1:54850427-54850449 CTCCAGAGGCCAAATGGGTAGGG + Exonic
914747776 1:150512225-150512247 CCCGAGAGGCCCAAAGGGAATGG - Intronic
915528745 1:156491340-156491362 CTGGGGAGGCCCAAAGGGAAGGG + Intronic
918924236 1:190760164-190760186 CTAGACAGGCCACATGGGGAAGG + Intergenic
1063049618 10:2432979-2433001 CTAGGGAGACCCAGTGGGGAGGG - Intergenic
1064347325 10:14544103-14544125 TTAGAGAGGCCCACACGGGAAGG + Intronic
1067051864 10:43026220-43026242 CTTGGGAGGCCTGATGGGGATGG + Intergenic
1069612038 10:69780298-69780320 CTCGAGAGGCCCACTTGGCACGG - Intergenic
1070300686 10:75201742-75201764 CTAGAGGGGCACAATGGGATGGG - Intergenic
1072921505 10:99580949-99580971 CTAGAGAGGCACTCTGGGGAGGG + Intergenic
1073077714 10:100835126-100835148 CTAGGGAGGCCCCTTGGAGAAGG - Intergenic
1073223672 10:101897677-101897699 TTAGAAAGTCCCAAAGGGGAAGG + Intronic
1073547439 10:104362894-104362916 CTAGAGAGGCTGACTGGGGCAGG - Intronic
1073636561 10:105204974-105204996 CTAGAGAGGACCATTGAGAAGGG - Intronic
1073979741 10:109141351-109141373 CTATACAGTACCAATGGGGATGG - Intergenic
1075174439 10:120146065-120146087 CTAGGGATGACCTATGGGGATGG - Intergenic
1075722057 10:124593084-124593106 CCAGAGCGGGCCAGTGGGGAGGG - Intronic
1076437158 10:130454222-130454244 CTGAAGGGGCCCTATGGGGAGGG + Intergenic
1077415954 11:2424358-2424380 CTCCAGAGGCCTAATGGGGAGGG - Intergenic
1080018464 11:27532872-27532894 CTAGAAAGGAGCAATGGGGAGGG - Intergenic
1082820845 11:57543717-57543739 CCTGAGAGCCCCACTGGGGAGGG + Exonic
1083169452 11:60914359-60914381 CTGGAGAGTCCGAGTGGGGAGGG + Intronic
1083277265 11:61603838-61603860 CAACATGGGCCCAATGGGGAAGG - Intergenic
1084096516 11:66915076-66915098 CTAGGGTGCGCCAATGGGGAGGG + Intronic
1084412791 11:69013910-69013932 CTCCAGGGGCTCAATGGGGAAGG - Intergenic
1084800850 11:71542986-71543008 TTTGAAAGGCCCAATGTGGATGG + Intronic
1084961029 11:72716850-72716872 CCAGAGAGGCCCGTTGGGTAGGG - Intronic
1085041494 11:73328927-73328949 CTAGAGAGGCAGGATGGAGAAGG + Intronic
1089666180 11:120021422-120021444 CTACAGAGGCCTACTAGGGAAGG + Intergenic
1090036567 11:123254573-123254595 CTTGAGAGGCCGAAGTGGGACGG - Intergenic
1091693547 12:2612763-2612785 CTACAGAGGCCCAGGGTGGAAGG - Intronic
1092315040 12:7402546-7402568 CTAGAGAGTCCTAAGTGGGAGGG - Intronic
1093993628 12:25617584-25617606 CTAGAGAGTGAAAATGGGGAAGG + Intronic
1095957244 12:47813765-47813787 CCAGAGAGGCCCAGGGTGGAAGG + Intronic
1096154512 12:49334501-49334523 CTAGAGAGTCCCACAGGGGCTGG + Intronic
1096463239 12:51834408-51834430 CCACAGAAGCCCAATGGGGTGGG - Intergenic
1096799586 12:54101272-54101294 CCAGAGAGGGGCACTGGGGATGG + Intergenic
1100407368 12:94283349-94283371 CTTGAGAGGGGCAATGGAGAGGG + Intronic
1101640514 12:106583237-106583259 CTAGAGATGCCCAGGGAGGAAGG - Intronic
1102143124 12:110633217-110633239 ATAGTGAGGCCCCTTGGGGATGG - Intronic
1102171325 12:110844740-110844762 TTACATAGGCTCAATGGGGAAGG + Intergenic
1104538072 12:129637466-129637488 CTACACAGGACCAAGGGGGATGG - Intronic
1113333720 13:109357639-109357661 CTAGACAGACCTAGTGGGGATGG - Intergenic
1113945424 13:114041254-114041276 CTTGGGAGGCCCAGGGGGGAGGG + Intronic
1115633166 14:35265823-35265845 ATAGAGAGGCTCAAGAGGGATGG - Intronic
1118345498 14:64937825-64937847 CTTGAGAAGCCCAATGCTGAAGG - Intronic
1119862176 14:77944113-77944135 CCAGAGAGGCCCAAGGTGGTGGG - Intergenic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121108645 14:91297049-91297071 CGGGAGAGGCACAGTGGGGACGG - Intronic
1121642629 14:95495929-95495951 CTTGAGAGGCCCACTGGGGAAGG - Intergenic
1123587885 15:21775137-21775159 TTTGGGAGGCCAAATGGGGAGGG - Intergenic
1123624523 15:22217702-22217724 TTTGGGAGGCCAAATGGGGAGGG - Intergenic
1125391189 15:39194900-39194922 CTAGACAAGCCCAATGGAGCAGG + Intergenic
1131073322 15:89479498-89479520 CCAGACAGGCCCAATGGGCCCGG + Intronic
1133276134 16:4639463-4639485 CTAATGATGCCCAATGGTGAAGG - Intronic
1137913439 16:52403029-52403051 CTATGGAGGCCCAATTGGGCTGG - Intergenic
1138028515 16:53540857-53540879 CTAGAGAGGCCCATTGTAGCTGG - Intergenic
1142787427 17:2235092-2235114 CTGGTGAGGCCCAAAGGGGAGGG - Intronic
1143511311 17:7396709-7396731 CCAGAGTGGCCCAAAGGGGCTGG - Intronic
1143608833 17:8006168-8006190 GAAGAGAGAGCCAATGGGGAGGG + Intronic
1143894312 17:10124334-10124356 CTGGAGAGACCCAATGGGACGGG + Intronic
1144642048 17:16943003-16943025 CTGGAGAGTCCCAGTGGAGAGGG + Intronic
1145207816 17:20994107-20994129 GTGGAGAGGCCCCATGGAGAGGG - Intergenic
1146301311 17:31691786-31691808 CCAGAGAGGCCCGAGGGGGCTGG - Intergenic
1146473440 17:33142725-33142747 CCAGTGAGGCCCAAAGGAGAAGG - Intronic
1147949730 17:44100339-44100361 CTAGAGAAGCCCTGGGGGGAGGG + Intronic
1148239950 17:45993783-45993805 GTCGAGGGGCCCAAGGGGGAGGG - Intronic
1148958427 17:51372771-51372793 CCAGCCAGGCCCAGTGGGGATGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1160591955 18:79950097-79950119 TTTCAGAGGCCCAGTGGGGAGGG + Intronic
1162911748 19:13851419-13851441 CTAGAGAGGGCCTAGGGGGTGGG - Intergenic
1163520581 19:17789231-17789253 CAAGAATGGCCCACTGGGGAGGG + Intergenic
1164418075 19:28062737-28062759 TTAGCTAGGCCCAATGAGGATGG + Intergenic
1168689225 19:58366865-58366887 CTCCAGAGGCCGAATGGGGCAGG - Intergenic
925154110 2:1637209-1637231 CTAGGGGGGTCCACTGGGGAGGG - Intronic
925182818 2:1827832-1827854 CTAGAGAGGACAGCTGGGGAGGG + Intronic
925309018 2:2868835-2868857 CTAGTGAGAGGCAATGGGGAAGG - Intergenic
928084786 2:28339218-28339240 CTGCAGAGGCCCAGAGGGGATGG - Intergenic
928402377 2:30988358-30988380 CCAGAGTGGGCCAATGGCGATGG + Intronic
931516323 2:63052419-63052441 CTACAAAGGGCCAATGTGGAGGG - Intronic
935146492 2:100399022-100399044 CTAGAGGGGGCCGATGGGGTTGG - Intronic
936750540 2:115635678-115635700 CTCTAGAAGCCCAATGGGGAGGG + Intronic
937036497 2:118786659-118786681 AGAGAGAAGCCCAGTGGGGACGG - Intergenic
937100697 2:119265790-119265812 CTAGAGCTGGCCAATGAGGAAGG + Intergenic
938735652 2:134184310-134184332 CTAGAGAGGCCAAAGTGGGCAGG - Intronic
938749975 2:134319063-134319085 CTAGAGAGGGACAGTGGTGATGG - Intronic
938989816 2:136616318-136616340 CTTGAGAGTATCAATGGGGAGGG - Intergenic
940922742 2:159327819-159327841 TTTGGGAGGCCCAATGGGGGCGG + Intronic
947203857 2:227642551-227642573 CTGGAGAGGACCCATGGAGAGGG + Intergenic
1169560055 20:6790212-6790234 ATAGAGAGGCCCATGGGGGACGG - Intergenic
1170493325 20:16900106-16900128 TTTGAGAGGCCCAATCGGGTGGG + Intergenic
1170571711 20:17636487-17636509 CCAGAGAGGCCCAAAGGGTGAGG - Intronic
1171796845 20:29573073-29573095 CCAGAGAGGGGCACTGGGGATGG - Intergenic
1171851403 20:30311090-30311112 CCAGAGAGGGGCACTGGGGATGG + Intergenic
1172093425 20:32449009-32449031 CTAGACTGGCCCAATAGGGAAGG + Intronic
1173667740 20:44774818-44774840 CCAGAGAGGACAAATGGGGGAGG - Intronic
1175370502 20:58485759-58485781 CTAGTTAGGCACAGTGGGGAAGG - Intronic
1179584250 21:42364936-42364958 CAAGAGAGGCCCCGTGGTGAGGG + Intronic
1183522522 22:38303627-38303649 CAGAAGAGGCCCAATGGGGCTGG + Intronic
1184103232 22:42352550-42352572 CTGCTGAGGCCCACTGGGGAAGG - Intergenic
950092077 3:10303025-10303047 CTGGGGAGGGGCAATGGGGAAGG + Intronic
950698955 3:14726878-14726900 CTGGAGAGGGGCAAAGGGGAGGG - Intronic
952424405 3:33159973-33159995 CTAGAGAGACGCAAAGTGGATGG + Intronic
954330043 3:49884966-49884988 CTGCAGAAGCTCAATGGGGAAGG + Intergenic
954400510 3:50317238-50317260 CTAGAGATGCCTGATGGGGCTGG - Intergenic
954448276 3:50558178-50558200 CTAGGAAGCCCCCATGGGGAAGG - Exonic
956933457 3:74072577-74072599 GTAGAGAGACCCCATGGAGACGG + Intergenic
959562985 3:107803630-107803652 CTAAAAAGGCCCACTTGGGAGGG - Intronic
960412348 3:117342794-117342816 GTAGAAAGGCCGAATGGAGAAGG - Intergenic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
961331931 3:126147606-126147628 CTGGTGAGGCCCAGTGGGGCAGG + Intronic
961480969 3:127180553-127180575 TTAGAGAGGCCCACTTGGGAGGG - Intergenic
962236471 3:133711593-133711615 CTAGAGGAGCACAAAGGGGAGGG - Intergenic
964406467 3:156353704-156353726 CTAGAGAGGCCCATGTGGCAGGG - Intronic
965177415 3:165353271-165353293 GAAGAGAGGCAGAATGGGGAAGG - Intergenic
965179128 3:165378560-165378582 CTACAGAGGCTGAGTGGGGAGGG + Intergenic
966794252 3:183698389-183698411 CCAGGGAGGCCCGGTGGGGATGG - Intronic
968288858 3:197523808-197523830 CAAGAGGGGGCCGATGGGGACGG + Intronic
979324570 4:119363767-119363789 TTAGATAGTCCCAATGAGGAAGG + Intergenic
982108505 4:152032091-152032113 CTAGACTGGCCTAATGTGGAAGG - Intergenic
983198836 4:164838524-164838546 CTAGAGAGGCCCACGTGGCAAGG + Intergenic
983242409 4:165248467-165248489 TTAGATAGTCCCAATGAGGAAGG + Intronic
988702071 5:33685447-33685469 CTAGAGAGTACCAAGGGAGAGGG - Intronic
989162439 5:38404338-38404360 TTAAAGAGGCCCAAAGGGGCTGG + Intronic
990310766 5:54535843-54535865 CTGGAGATGCCCTCTGGGGAAGG - Intronic
997860947 5:137415418-137415440 CTACAGAGGCCCAAGGTTGAGGG + Intronic
998371036 5:141661686-141661708 ATAGAGATGCCCAATGAGGGTGG + Exonic
999883497 5:155893556-155893578 CTAGAGAGGCATAATGAAGATGG + Intronic
1000076038 5:157787729-157787751 CTTGACAGGCACAATGGGAATGG - Exonic
1000208581 5:159087923-159087945 CTATAGAGGCCCCAAGGAGAGGG - Intronic
1000288204 5:159846221-159846243 ATAAAGAGACCCAATGGGGATGG - Intergenic
1001405986 5:171477980-171478002 TTAGAGAGGCCCTAAGGGGAGGG + Intergenic
1001759877 5:174198602-174198624 CTGGAGAGACCCAAGGGGGTAGG + Intronic
1002607003 5:180389463-180389485 CCAGAGAGACCGAGTGGGGATGG - Intergenic
1005471115 6:26163613-26163635 CTAGAGAGGTCTAACGGGCAAGG - Intronic
1006732819 6:36248954-36248976 CTAGAGAGGCCCAATGGGGAAGG + Intronic
1007421861 6:41724479-41724501 CCAGAGAGGCCCAGGGAGGATGG + Intronic
1007848738 6:44782868-44782890 CAAGAGAGGAGCAATGGAGATGG - Intergenic
1008520700 6:52360549-52360571 CTAGAGTGGCCCAAAGTGGAAGG + Intergenic
1011999724 6:93637926-93637948 TTATAGAGGCCAAATAGGGAAGG - Intergenic
1013040715 6:106430732-106430754 CTACAGACGCCCCATGGAGAGGG - Intergenic
1015687461 6:135881053-135881075 ATACAGAGACCCCATGGGGAGGG + Intronic
1015977172 6:138802120-138802142 ATAGAGAGGCCCACATGGGAGGG + Intronic
1018115490 6:160579626-160579648 CTTGGGAGGCATAATGGGGAAGG - Intronic
1019934919 7:4247880-4247902 CTGGAGGAGACCAATGGGGAGGG - Intronic
1021579030 7:22132954-22132976 CTGGAGAGGCGCAGTGGTGAGGG - Intronic
1024638498 7:51310274-51310296 CTGGAGAGGCCCCATCAGGATGG + Intronic
1027050112 7:75016505-75016527 CCAGAGAAGCCCAATGTGCAGGG + Intronic
1029382923 7:100225163-100225185 CCAGAGAAGCCCAATGTGCAGGG - Intronic
1032716259 7:134511656-134511678 CTAGAGAGGCACAATGACTATGG + Intergenic
1034204748 7:149305595-149305617 ACATAGAGGCCCAATGGGAAGGG + Intergenic
1034425233 7:151010508-151010530 CTAAAGAGGCTCAGTGGGGGAGG + Intronic
1035027485 7:155835605-155835627 CAGGCGAGGCCCAAGGGGGATGG + Intergenic
1040568159 8:48585147-48585169 CTAAAGAGAGCCCATGGGGAAGG - Intergenic
1040704643 8:50110839-50110861 CTAAATTGGGCCAATGGGGAGGG + Intronic
1042305049 8:67322452-67322474 TTTGGGAGGCCCAGTGGGGATGG + Intronic
1044593151 8:93933174-93933196 CTAGAGAGGCCCATGGAGAAAGG + Intergenic
1045345772 8:101292246-101292268 GTGGAGAGGCCACATGGGGAGGG - Intergenic
1051657925 9:19400374-19400396 CTAGAGAGGACCAGGTGGGAAGG - Intergenic
1053789180 9:41674376-41674398 CCAGAGAGGGGCACTGGGGATGG + Intergenic
1054155959 9:61640385-61640407 CCAGAGAGGGGCACTGGGGATGG - Intergenic
1054177461 9:61885729-61885751 CCAGAGAGGGGCACTGGGGATGG + Intergenic
1054660070 9:67695079-67695101 CCAGAGAGGGGCACTGGGGATGG - Intergenic
1054943281 9:70767538-70767560 TTAGGCAGGCACAATGGGGATGG + Intronic
1056941955 9:90963403-90963425 CTACAGAGGCACTATTGGGAAGG - Intergenic
1059028209 9:110659981-110660003 GCAGAGAGGCCCATTAGGGAGGG + Intergenic
1060208318 9:121695560-121695582 CTAGAGCTGCCCAGTGGGAATGG + Intronic
1061367685 9:130181115-130181137 ATAGTGAGACCCAGTGGGGAAGG + Intronic
1061644393 9:131988718-131988740 CTTGGGAGGCCAAAGGGGGAAGG - Intronic
1062325599 9:136011064-136011086 CCAGAGAGGTTCCATGGGGAAGG + Exonic
1062443309 9:136583179-136583201 CTAGGCAGGCACAATGGGCATGG - Intergenic
1062652532 9:137585598-137585620 CCTGAGAGGCCCAGTGAGGAAGG + Intronic
1185618187 X:1435990-1436012 CTGGGGAGGCGCACTGGGGAGGG - Intronic
1185623089 X:1465345-1465367 CTGCAGAGGCCCGGTGGGGAAGG - Exonic
1186307364 X:8276925-8276947 TGTGAGAGGCCCAATGGAGACGG + Intergenic
1186500401 X:10046084-10046106 CTGGAGAGGCTCAGTGTGGATGG + Intronic
1187687632 X:21831296-21831318 CTAGAGAGGCCCATGTGGCAAGG - Intergenic
1187718719 X:22130149-22130171 TTAGGGAGGGGCAATGGGGAGGG - Intronic
1189091580 X:38089000-38089022 CAGGAAAGGCCTAATGGGGAAGG + Intronic
1190443185 X:50496007-50496029 CTAGAGAGGGGCAATGAGTAGGG - Intergenic
1191636218 X:63379936-63379958 CTTGAGAGCCCTAATGGGGGAGG - Intergenic
1191806179 X:65136266-65136288 TGACAGAGGACCAATGGGGAGGG + Intergenic
1192314891 X:70043818-70043840 CTCAAGAGGCTCAATGTGGATGG + Intronic
1196756428 X:119161330-119161352 AAAGAGAGGCCAAATGAGGAAGG + Intergenic
1198310953 X:135425388-135425410 CTAGAGGGGCTGACTGGGGAGGG + Intergenic