ID: 1006735002

View in Genome Browser
Species Human (GRCh38)
Location 6:36267382-36267404
Sequence CCAGGTTAGCAGCTCCTCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006734994_1006735002 5 Left 1006734994 6:36267354-36267376 CCAGTCTGCCAGGCTCAGCCTTT 0: 1
1: 0
2: 3
3: 43
4: 465
Right 1006735002 6:36267382-36267404 CCAGGTTAGCAGCTCCTCCACGG No data
1006734990_1006735002 28 Left 1006734990 6:36267331-36267353 CCAGCCCTTGTCAGCTGTGGAGA 0: 1
1: 1
2: 0
3: 19
4: 178
Right 1006735002 6:36267382-36267404 CCAGGTTAGCAGCTCCTCCACGG No data
1006734998_1006735002 -3 Left 1006734998 6:36267362-36267384 CCAGGCTCAGCCTTTGGGGTCCA 0: 1
1: 0
2: 0
3: 38
4: 261
Right 1006735002 6:36267382-36267404 CCAGGTTAGCAGCTCCTCCACGG No data
1006734991_1006735002 24 Left 1006734991 6:36267335-36267357 CCCTTGTCAGCTGTGGAGACCAG 0: 1
1: 0
2: 2
3: 14
4: 171
Right 1006735002 6:36267382-36267404 CCAGGTTAGCAGCTCCTCCACGG No data
1006734992_1006735002 23 Left 1006734992 6:36267336-36267358 CCTTGTCAGCTGTGGAGACCAGT 0: 1
1: 0
2: 0
3: 16
4: 139
Right 1006735002 6:36267382-36267404 CCAGGTTAGCAGCTCCTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006735002 Original CRISPR CCAGGTTAGCAGCTCCTCCA CGG Intronic
No off target data available for this crispr