ID: 1006735050

View in Genome Browser
Species Human (GRCh38)
Location 6:36267609-36267631
Sequence TGAAGCCCATGTACAGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006735042_1006735050 -6 Left 1006735042 6:36267592-36267614 CCAGCCCCCCAGGTGCCTGAAGC 0: 1
1: 0
2: 2
3: 38
4: 756
Right 1006735050 6:36267609-36267631 TGAAGCCCATGTACAGCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 149
1006735043_1006735050 -10 Left 1006735043 6:36267596-36267618 CCCCCCAGGTGCCTGAAGCCCAT 0: 1
1: 0
2: 0
3: 18
4: 276
Right 1006735050 6:36267609-36267631 TGAAGCCCATGTACAGCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 149
1006735040_1006735050 -4 Left 1006735040 6:36267590-36267612 CCCCAGCCCCCCAGGTGCCTGAA 0: 1
1: 0
2: 10
3: 163
4: 2745
Right 1006735050 6:36267609-36267631 TGAAGCCCATGTACAGCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 149
1006735041_1006735050 -5 Left 1006735041 6:36267591-36267613 CCCAGCCCCCCAGGTGCCTGAAG 0: 1
1: 0
2: 3
3: 43
4: 958
Right 1006735050 6:36267609-36267631 TGAAGCCCATGTACAGCAGGTGG 0: 1
1: 0
2: 1
3: 16
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006735050 Original CRISPR TGAAGCCCATGTACAGCAGG TGG Intronic
904602150 1:31679633-31679655 TGCAGCCCAGGTACTCCAGGGGG + Exonic
907319590 1:53594272-53594294 TGCAGCCTATGAGCAGCAGGAGG - Exonic
907383331 1:54109342-54109364 TGGAGCCAAAGTGCAGCAGGAGG + Intronic
907800839 1:57763771-57763793 TGAATCCCCTGTACAGTAAGCGG + Intronic
910283587 1:85529010-85529032 AGAAGGCCATATGCAGCAGGAGG + Intronic
912699383 1:111865299-111865321 TGAAGCCAAACTACAGTAGGGGG + Intronic
914206428 1:145533980-145534002 AGAAGGCCATATGCAGCAGGAGG - Intergenic
916495864 1:165346049-165346071 TGAAGTCCAGATACAGCATGTGG + Intronic
916653468 1:166851637-166851659 GGATGAGCATGTACAGCAGGGGG + Exonic
916818779 1:168378268-168378290 TGTAGACCATGAACAGGAGGAGG - Intergenic
918072202 1:181141348-181141370 AGAAGCTCATGTACATAAGGAGG + Intergenic
919945882 1:202318772-202318794 TGAAGAGCAGGTACAGCAGTGGG - Exonic
920457243 1:206110440-206110462 TGAAGCCCATGTAGATCCAGGGG + Exonic
922516427 1:226211430-226211452 TGGAGGCCATGGACGGCAGGAGG + Intergenic
923348220 1:233078553-233078575 TGTAAGCCTTGTACAGCAGGAGG - Intronic
924825325 1:247532289-247532311 TGAAGCTCATGTCCAGGAAGGGG + Exonic
1062772334 10:112529-112551 TGAAGCCTTTGTTCAGCAGGTGG - Intergenic
1062917747 10:1254874-1254896 TGAAGCTCAGGTACAGCAAATGG - Intronic
1066063656 10:31746201-31746223 TGAAGCCCATGGCCAGGTGGCGG - Intergenic
1066713919 10:38265911-38265933 TGAAGCACATCTCCTGCAGGAGG - Intergenic
1067289302 10:44929719-44929741 TGCCACTCATGTACAGCAGGAGG + Intronic
1070330127 10:75410393-75410415 TGAAGCCAGTGCAGAGCAGGAGG + Intergenic
1070653674 10:78256002-78256024 TGAAGGCCATGTCCATCAGAAGG + Intergenic
1076395352 10:130134868-130134890 CAAAGCCCAGGGACAGCAGGGGG + Intergenic
1076858472 10:133128668-133128690 TGAAGACCATGTCCAGGAAGTGG - Exonic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1078456833 11:11482220-11482242 GGAAGCCCATGTGCAGTCGGAGG + Intronic
1079394539 11:20050472-20050494 TGAGGCCCACCTACAGCTGGGGG - Intronic
1080325066 11:31062087-31062109 TGAGGGCCAGGTACAGCATGGGG + Intronic
1082653801 11:55827602-55827624 TGGTCACCATGTACAGCAGGGGG - Exonic
1082944264 11:58741228-58741250 TGAAGGCTATGGACAGCAGGGGG + Intergenic
1088230783 11:107671610-107671632 TGAGGCCCATGTCCAGGATGAGG - Intergenic
1090154610 11:124424469-124424491 TGGTGACCATGTAGAGCAGGGGG + Exonic
1094820644 12:34221476-34221498 GGGAGGCCATGCACAGCAGGTGG - Intergenic
1106553744 13:30792704-30792726 CCAAGCCCATGGCCAGCAGGAGG - Intergenic
1107156807 13:37176936-37176958 TGAATCCCATGTAAAGGAAGAGG - Intergenic
1111075092 13:83224227-83224249 TGATGATCATGTACAGCAAGAGG - Intergenic
1112841349 13:103582703-103582725 TAAAGCCCAGGTAGAGCTGGGGG - Intergenic
1114160359 14:20158952-20158974 AGAAGGTCATGTACAGCTGGTGG + Intergenic
1114223003 14:20713820-20713842 TGAAGGCAATGTCCAGCAGTTGG + Intergenic
1114850007 14:26372590-26372612 TGAAGCCCATTTCTAGCAGTGGG + Intergenic
1119840694 14:77790691-77790713 TGAAGCCCATTGACAGCTGGGGG + Intergenic
1122828745 14:104385091-104385113 TCAAGCCCAGGCACAGGAGGCGG + Intergenic
1123932305 15:25177784-25177806 TGCAGCCCATGTCCCGCTGGGGG + Intergenic
1125313818 15:38409641-38409663 TGAAGCCCAGATAAAGGAGGTGG - Intergenic
1125380354 15:39080530-39080552 GGAAGACCATGTATATCAGGAGG + Intergenic
1127810568 15:62561715-62561737 TGAAGACCAAGGACAGCAGCAGG - Intronic
1128252080 15:66170810-66170832 TGCAGCCCCTGTCCAGGAGGTGG + Intronic
1130172585 15:81531158-81531180 TGCAGCCCATATGGAGCAGGAGG - Intergenic
1131024649 15:89129695-89129717 TGAAGCCACTGGCCAGCAGGGGG - Intronic
1131911988 15:97216307-97216329 TGAAGCCTATCTTTAGCAGGAGG + Intergenic
1133239861 16:4407957-4407979 TGGAGCCCGAGGACAGCAGGTGG - Intronic
1133399205 16:5472383-5472405 TTAAACCCATTTGCAGCAGGGGG + Intergenic
1133616602 16:7482838-7482860 TGAACACCATGTACAGGAGATGG + Intronic
1133935347 16:10264811-10264833 AGAAGCCCATGTGCAGGCGGAGG + Intergenic
1134413264 16:14021147-14021169 AGAAGCCCATGGATAGCATGTGG + Intergenic
1135643959 16:24145190-24145212 TGAGTCCCAAGTACAGTAGGAGG + Intronic
1141268564 16:82518980-82519002 TGTAACACATTTACAGCAGGGGG + Intergenic
1142950232 17:3472260-3472282 TGAAGCCCAGGTTCAGATGGCGG + Intronic
1143471207 17:7177252-7177274 TGAGGCCCAGGGAGAGCAGGAGG + Exonic
1144284555 17:13761003-13761025 GGATGCCCAGGGACAGCAGGAGG + Intergenic
1145068661 17:19783711-19783733 TGAAGCCCCTGAACTGCCGGAGG - Exonic
1145750459 17:27351634-27351656 TGAAGCCCTTGTGCAGTTGGAGG - Intergenic
1147285892 17:39402181-39402203 TGAACCCAAAGTGCAGCAGGCGG + Intronic
1147458769 17:40555155-40555177 AGAAGCTCATGGCCAGCAGGGGG + Exonic
1148197172 17:45722335-45722357 TGAGGCCACTGTCCAGCAGGGGG + Intergenic
1149799337 17:59552537-59552559 TGAAGCCCATAAACAGTTGGCGG + Intergenic
1150339877 17:64357821-64357843 TGAAGCCCATGTGAAGCTGTTGG - Intronic
1151182274 17:72337874-72337896 TGTAGCCCAGCTACAGCATGTGG - Intergenic
1151240049 17:72750363-72750385 TGATGCCCATGTACGGCCTGTGG - Intronic
1151434148 17:74083738-74083760 TGAAGCTCATGTAGTGCATGAGG - Intergenic
1151544687 17:74785577-74785599 TGAAGCCCAGGAACACCAGCAGG - Exonic
1152045428 17:77931818-77931840 TGCAGCCCATGCACGGCACGTGG + Intergenic
1152775294 17:82197718-82197740 TGACGCCCATCCACAGGAGGAGG - Intronic
1154346617 18:13548336-13548358 TGAATGCCATGAACAGCAGCAGG - Intronic
1155249910 18:23944609-23944631 GAAAGCCCTGGTACAGCAGGTGG + Intronic
1158525062 18:58205985-58206007 GGAAGCCATTGTACAGAAGGTGG - Intronic
1162227449 19:9235527-9235549 TGATGACCATGTACTGCAGTGGG - Intergenic
1163078332 19:14916798-14916820 TGATGACCATGTAGTGCAGGGGG - Intergenic
1167467838 19:49659435-49659457 TGAAGACCAAGCACTGCAGGGGG - Intergenic
1167583190 19:50358522-50358544 TGAAGCGCATGCGCAGCGGGTGG - Exonic
1168092693 19:54096049-54096071 CGAAGCTCATGTTCCGCAGGCGG + Exonic
1168122374 19:54258942-54258964 TGAAGTCCATGATCAGCATGGGG + Intronic
925538192 2:4938502-4938524 TGCAGCCTCTGTACAGCAAGAGG - Intergenic
926081616 2:9991318-9991340 AGAAGCCCATGTACTACAGATGG - Intronic
928394258 2:30931771-30931793 TGGAGCCCATGCCCTGCAGGAGG + Intronic
929948502 2:46388550-46388572 TGATGCCCATGTTCAGATGGGGG + Intergenic
931116214 2:59169497-59169519 TGAAGCCCAAGTCCATAAGGAGG - Intergenic
934614319 2:95761867-95761889 TGAATCCCTTTTACAGCATGGGG + Intergenic
934646580 2:96062620-96062642 TGAATCCCTTTTACAGCATGGGG - Intergenic
934839980 2:97618702-97618724 TGAATCCCTTTTACAGCATGGGG - Intergenic
942513198 2:176724383-176724405 TGAAGCCCTTGGTCAGCAAGTGG - Intergenic
942613285 2:177763631-177763653 TGAGTCCCATGGACAGCAGCGGG - Intronic
945480402 2:210338311-210338333 TGAAGCCCCAGTACAGGAGAGGG - Intergenic
947115245 2:226763179-226763201 TGAAGGCCTTGTACTGCTGGAGG + Intronic
948776187 2:240290181-240290203 TGAGGCCCGTGGAGAGCAGGGGG - Intergenic
1169083952 20:2815601-2815623 TGAAGGTCCTGGACAGCAGGAGG + Exonic
1170681612 20:18531014-18531036 ACATGCCCATGTCCAGCAGGTGG - Intronic
1170773668 20:19356804-19356826 TGATGACCATGTAGAGCAGTAGG - Intronic
1173233032 20:41217094-41217116 TGGAGCCCATCTACCACAGGAGG + Intronic
1178894187 21:36545086-36545108 TGAAGCCCATGGAGAGAGGGAGG + Intronic
1178897999 21:36576580-36576602 TGAGGCCCAGCTAAAGCAGGGGG - Intergenic
1182495453 22:30704005-30704027 GGAAGCACATGAACAGCACGAGG + Intronic
951378727 3:21956306-21956328 GGAAGCCCCTATACAGCAGGTGG - Intronic
956471336 3:69570244-69570266 TGAAGCCAATGTAAAGCCGGAGG - Intergenic
967986093 3:195096260-195096282 TGCAGCCCATGCACAGCAGGAGG + Intronic
968905916 4:3450396-3450418 TGAGGCCCATGCACAGCAGCAGG - Intergenic
970242787 4:14026882-14026904 ATAACCTCATGTACAGCAGGGGG - Intergenic
977676801 4:99757114-99757136 TGAAGCGCGGGTAAAGCAGGAGG + Intergenic
980175369 4:129338202-129338224 TGAAGCCCAGGTACAGTATGTGG + Intergenic
985671396 5:1208792-1208814 CGAACTCCAGGTACAGCAGGGGG - Exonic
986262445 5:6160164-6160186 TGAAGTCAAGGAACAGCAGGAGG - Intergenic
987146811 5:14999422-14999444 TGAAGTCCTTGTAGAGCTGGAGG + Intergenic
990412149 5:55552108-55552130 TCAATCCCATGTACATGAGGTGG + Intergenic
992362258 5:76052001-76052023 TGTAGCCCATGATCAGCATGTGG + Intergenic
993418671 5:87671373-87671395 TGCAGCCCATTTATAGCAGATGG - Intergenic
994403588 5:99315166-99315188 TGAAACACATGAACATCAGGAGG + Intergenic
994882027 5:105510570-105510592 TTAAGGCCATGTACAGCAAAGGG + Intergenic
1000018787 5:157301371-157301393 TGAAGCCAATGTAGAGGAGGAGG - Intronic
1000157720 5:158568279-158568301 TGGAGCCCAGGTTCAGGAGGAGG - Intergenic
1002080229 5:176733257-176733279 AAAAGCCCAGGCACAGCAGGTGG - Intergenic
1002422903 5:179158867-179158889 TGAGGCTCATGGACTGCAGGGGG + Exonic
1002529639 5:179836467-179836489 AGAAGCCCATGGACAGCATCTGG - Exonic
1002561227 5:180083610-180083632 TGAAGCCCAGCTCAAGCAGGAGG + Intergenic
1002576958 5:180179339-180179361 GGAAGCCCAGGGACAGGAGGGGG + Intronic
1006735050 6:36267609-36267631 TGAAGCCCATGTACAGCAGGTGG + Intronic
1009479511 6:64139399-64139421 TGATTACCATGTTCAGCAGGTGG + Intronic
1011803595 6:91046295-91046317 TGAAGGCGATGTACAGCCGCAGG - Intergenic
1011864568 6:91808106-91808128 TGAAGCCAATTTCCTGCAGGTGG + Intergenic
1013160879 6:107543541-107543563 TGAAGCCCATGGGCAGCATGGGG + Intronic
1015679751 6:135792638-135792660 TGAGGCCCACGTACATTAGGGGG + Intergenic
1017975495 6:159353351-159353373 TGAAGGCCCTGCACAGCAGCAGG - Intergenic
1018262982 6:161989323-161989345 TGGTGCCCATGCACATCAGGGGG + Intronic
1018415802 6:163601168-163601190 AGAAGCCCATGAACATGAGGCGG - Intergenic
1019055692 6:169221695-169221717 TGAAGCCCATGGACAGAGTGTGG + Intronic
1019256197 7:53722-53744 TAAACCCCAAGTGCAGCAGGCGG + Intergenic
1019383079 7:738073-738095 TGAAGCACATGTACAGCATCTGG - Intronic
1020769657 7:12373165-12373187 TGAAGTCCATGTACGTCAGTGGG - Exonic
1021269907 7:18573727-18573749 TGGAGCACATGTACTGCACGCGG + Intronic
1022621229 7:31986614-31986636 AGAAGGCCATGTGAAGCAGGAGG + Intronic
1022795949 7:33731485-33731507 AGAAGGCCATGTGCAGGAGGCGG - Intergenic
1023508164 7:40921734-40921756 TGAGGCCCACGAAAAGCAGGAGG - Intergenic
1024609012 7:51046811-51046833 TGAAACCCAGGGGCAGCAGGAGG + Intronic
1026320417 7:69263167-69263189 TGAAGATGATGTAAAGCAGGTGG - Intergenic
1027640903 7:80732823-80732845 TGTAGCCAATGAACAGCAGGGGG - Intergenic
1027757092 7:82227963-82227985 TAAAGGACATGTACAGCCGGGGG - Intronic
1031992510 7:128207476-128207498 TGAAGCCCAGGCACAGCAGAGGG + Intergenic
1032780858 7:135164471-135164493 TGATGCTCATGAACAGCAGCTGG - Exonic
1034053366 7:148007101-148007123 TAAAGCACATGTACTGCATGTGG - Intronic
1034069238 7:148166731-148166753 TGAAGCCCTTGCATGGCAGGGGG + Intronic
1043146632 8:76664568-76664590 TTAAGCCCAAGTAAAACAGGTGG - Intergenic
1048078080 8:131095171-131095193 AGAAGCCCATGTAAAGAAAGAGG + Intergenic
1049094654 8:140541160-140541182 TGAAGGCCAGTTCCAGCAGGTGG - Exonic
1050106777 9:2174048-2174070 TTATGCCCACGTACAGCAGGTGG + Intronic
1050458392 9:5856001-5856023 TCAATCCCATGTACACCAGGTGG + Intergenic
1051662838 9:19441701-19441723 TGAAGTCGATGTTCAGCAGAGGG - Intronic
1051898184 9:22009756-22009778 TGAAGCCCAAGTACTGCCTGGGG - Intronic
1053168555 9:35861845-35861867 TGGAGCCCTTGTCCAGGAGGTGG - Intergenic
1053408291 9:37896967-37896989 TCAAGGCCCCGTACAGCAGGAGG + Intronic
1056048802 9:82746555-82746577 TGCATCCCATGTACAGAAGGGGG - Intergenic
1059782181 9:117541415-117541437 AGAACCCCATGAACACCAGGGGG - Intergenic
1060302847 9:122385786-122385808 TGAAGCCCATTAAAAGAAGGTGG - Intronic
1062092942 9:134688100-134688122 GGAAGCCCCTGGCCAGCAGGAGG + Intronic
1187889529 X:23921154-23921176 TCAAGCCTGTGTACAGCAAGGGG - Intronic
1190319089 X:49169258-49169280 TGAAGGGCATTGACAGCAGGGGG + Intergenic
1197285904 X:124594198-124594220 TGAAGCCCAAGTACACAAGGGGG - Intronic
1199534528 X:148887258-148887280 TGAAGCCCAACTCAAGCAGGAGG - Intronic