ID: 1006735067

View in Genome Browser
Species Human (GRCh38)
Location 6:36267710-36267732
Sequence AAGGGTAAGCAGGCGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 450}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006735067_1006735079 19 Left 1006735067 6:36267710-36267732 CCCTCCTCCGCCTGCTTACCCTT 0: 1
1: 0
2: 2
3: 31
4: 450
Right 1006735079 6:36267752-36267774 GGGATCTCTGTCCTTGGTTCTGG 0: 1
1: 0
2: 1
3: 11
4: 162
1006735067_1006735075 -2 Left 1006735067 6:36267710-36267732 CCCTCCTCCGCCTGCTTACCCTT 0: 1
1: 0
2: 2
3: 31
4: 450
Right 1006735075 6:36267731-36267753 TTCTCTGCTGCCTCAGTGGCAGG No data
1006735067_1006735078 13 Left 1006735067 6:36267710-36267732 CCCTCCTCCGCCTGCTTACCCTT 0: 1
1: 0
2: 2
3: 31
4: 450
Right 1006735078 6:36267746-36267768 GTGGCAGGGATCTCTGTCCTTGG 0: 1
1: 0
2: 1
3: 22
4: 218
1006735067_1006735072 -6 Left 1006735067 6:36267710-36267732 CCCTCCTCCGCCTGCTTACCCTT 0: 1
1: 0
2: 2
3: 31
4: 450
Right 1006735072 6:36267727-36267749 ACCCTTCTCTGCTGCCTCAGTGG 0: 1
1: 0
2: 3
3: 34
4: 329
1006735067_1006735076 -1 Left 1006735067 6:36267710-36267732 CCCTCCTCCGCCTGCTTACCCTT 0: 1
1: 0
2: 2
3: 31
4: 450
Right 1006735076 6:36267732-36267754 TCTCTGCTGCCTCAGTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006735067 Original CRISPR AAGGGTAAGCAGGCGGAGGA GGG (reversed) Intronic
900183179 1:1321316-1321338 CAGGGGAAGCTGGCGGGGGAGGG - Intronic
900280287 1:1862801-1862823 AAAGGTAAGGAAGCTGAGGAGGG + Intronic
900540986 1:3202571-3202593 AAGGGTCTGCAGGTGAAGGATGG + Intronic
900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG + Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901258992 1:7857275-7857297 AAGGGTGAGTAGGGAGAGGAAGG - Intergenic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901469312 1:9444803-9444825 AGAGGTTAGCAGGCGGAGCATGG - Intergenic
901834343 1:11914169-11914191 AAGGGTAGCCAGTCTGAGGATGG + Intergenic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
903149741 1:21398313-21398335 AAGGGTCAGGAGGCCGGGGAGGG - Intergenic
903553935 1:24179798-24179820 AGGGGAAAGCAGGAAGAGGAGGG - Intronic
903657179 1:24956648-24956670 TGGGGTAAGCAGGGGCAGGAGGG - Intronic
904900051 1:33849980-33850002 AAGGGTAAAGAGGAGGAGGCAGG - Intronic
906712208 1:47939190-47939212 TAGGGTATGCAGGCAGAAGATGG + Intronic
907860578 1:58349019-58349041 ATGGGACAGCAGGCGGAGGCAGG - Intronic
908833640 1:68206931-68206953 AAGGACAAGGAGGGGGAGGAGGG - Intronic
911757485 1:101575892-101575914 AAGAGTAAACAGCCGGAGGCAGG + Intergenic
913552316 1:119927610-119927632 AGGGGGAAGCAGGAGAAGGAAGG - Intronic
914343053 1:146776517-146776539 CAGCCTAAGCAGGCGGAGTAGGG - Intergenic
915385254 1:155485421-155485443 AAGGCTGAGCGGGGGGAGGATGG - Intronic
915970243 1:160349833-160349855 AAGGGGAAGCAGGAGAGGGAAGG - Intronic
915984337 1:160448749-160448771 GAGGGCAAGGAGGAGGAGGAGGG - Intergenic
916025256 1:160827950-160827972 AAGGGTGAGAAGGAGGGGGAGGG - Exonic
916260168 1:162833991-162834013 GAGGGTAAGCAGGAGGTGGCAGG + Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
917452885 1:175161862-175161884 AAGGGTAATGAGGAAGAGGAAGG - Intronic
917514952 1:175699548-175699570 AGGGCTAAGCAGGCTAAGGAGGG + Intronic
918023087 1:180714235-180714257 AAGGATGAGAAGGAGGAGGAAGG - Intronic
918246317 1:182662824-182662846 TATGGTAAGCAGCTGGAGGAGGG - Intronic
918472270 1:184886274-184886296 CAGGGTAGGGAGGCGGGGGAGGG + Intronic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919727990 1:200896050-200896072 AAGGGGAAGCTGGCGGAGACGGG + Intronic
920717034 1:208349826-208349848 AAAGGGAGGCAGGCAGAGGAGGG + Intergenic
921119071 1:212120953-212120975 AGAGGTCAGCAGGTGGAGGATGG - Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921699206 1:218248110-218248132 GAGGGTGAGCAGGGGGAGGTTGG + Intergenic
922572018 1:226639927-226639949 AAGGGCATCCAGGCTGAGGATGG + Intronic
922790072 1:228306401-228306423 CAGAGTCTGCAGGCGGAGGAGGG + Exonic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
922931946 1:229396890-229396912 CAGGGTAAGTGGGCTGAGGATGG - Intergenic
1062973101 10:1663423-1663445 AGGGATGAGCAGGCGGAGCACGG - Intronic
1063161871 10:3424299-3424321 AAGGGATAGCAGGCGGAGCGGGG - Intergenic
1063901505 10:10737619-10737641 AAGGGGATTCAGGCAGAGGATGG - Intergenic
1064971041 10:21067465-21067487 AAGAGAAAGCAGGAGGAGGGAGG + Intronic
1066119140 10:32267046-32267068 AAGGATAATAAGGCCGAGGATGG - Intergenic
1067973469 10:50996923-50996945 AAGGGGAGGAAGGCTGAGGAAGG + Intronic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG + Intergenic
1071933471 10:90499819-90499841 AAGAGTATGGAGTCGGAGGAGGG + Intergenic
1072278081 10:93842200-93842222 CAGGGTAAGCAGGCTTAGGATGG - Intergenic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072801186 10:98393432-98393454 AAGGGGAAGCAGCTGGAGAATGG - Intronic
1072898204 10:99385351-99385373 AAGGGAAAGTAGGGGAAGGAAGG - Intronic
1072917388 10:99546965-99546987 AAGGGTTAGCGGGAGCAGGATGG - Intergenic
1073597710 10:104817381-104817403 AGGGGGAAGGAGGAGGAGGAGGG - Intronic
1074296436 10:112193493-112193515 AAGGGCAAACAGGCAGATGATGG + Intronic
1077150767 11:1072172-1072194 GAGGGAAAGGAGGAGGAGGAAGG - Intergenic
1077308048 11:1876621-1876643 AAGTGTCTGCAGGGGGAGGACGG + Intronic
1077439543 11:2561660-2561682 ATCGCTAAGCAGGAGGAGGATGG - Intronic
1078155593 11:8797447-8797469 AAGGGGAAGAAGGAGGAAGAAGG - Intronic
1078241404 11:9534006-9534028 AAGGGCAAGCAGGAGGGGAAGGG - Intergenic
1081623794 11:44634816-44634838 AAGGGTAAGCCGGCCGGGGGCGG - Intergenic
1081851029 11:46275452-46275474 AAGGGGTGGCAGGGGGAGGAGGG - Intergenic
1082123598 11:48406459-48406481 AAGGGCAATCAGGCAGGGGAAGG + Intergenic
1082194380 11:49284500-49284522 AAGGGGAAGGAGGGGAAGGAAGG - Intergenic
1082198705 11:49335914-49335936 GAGGGGAAGGAGGCAGAGGAGGG + Intergenic
1082921316 11:58497712-58497734 AAGGGTGAGAAGGAGGAAGAGGG + Intergenic
1083367714 11:62151554-62151576 AAGGTTAAGCTGCCAGAGGAAGG + Intronic
1083446203 11:62709439-62709461 AAAGGTAAACAGGCCGAAGAGGG + Intronic
1083876173 11:65525368-65525390 AAGGGGTAGCAGGCCGGGGAGGG + Intronic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1085057505 11:73414757-73414779 AAGGGTATGCAGGCAGAGCCTGG + Intronic
1087831057 11:102820212-102820234 GAGGGTAAGCAGGAGCAGGGTGG - Intergenic
1088577494 11:111285871-111285893 AGGGGTAAGGAGGCGGGGTAGGG - Exonic
1088626483 11:111733807-111733829 AAGGGCAGGCAGGCAGTGGAAGG + Intronic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1088878370 11:113954455-113954477 CAGGGTAAGCAGGCTTAGGACGG + Intergenic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1091077058 11:132629066-132629088 CAGGGCAAGCAGGCTTAGGATGG - Intronic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1091382460 12:70920-70942 AAGGGTAGTGAGGCAGAGGAGGG - Intronic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091866355 12:3840676-3840698 AAAAGGAAGCAGGCGGAGAATGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092239474 12:6828352-6828374 AAGGGGAGGGAGGGGGAGGAAGG - Intronic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1095085830 12:38056648-38056670 AAGGGTGAGCAAGCGGTGGGGGG + Intergenic
1095540125 12:43299919-43299941 AAGGGGAAGGAGGAGGAGGTGGG + Intergenic
1096280857 12:50252200-50252222 AAGTGAAGGCAGGAGGAGGAAGG + Intronic
1097351401 12:58553209-58553231 AAGGGTAGGAAGGAGGAGCAGGG - Intronic
1098081508 12:66790887-66790909 AAGGGGAAGGAGCGGGAGGAAGG + Intronic
1100550689 12:95644204-95644226 GAGGGGAAGGAGGGGGAGGAGGG - Intergenic
1103219475 12:119231884-119231906 AAGGAGAAGGAGGGGGAGGAGGG - Intergenic
1104045762 12:125161548-125161570 AAGGGAAATCAGGAGGAGAATGG - Intergenic
1104464840 12:128981985-128982007 AAGGGTATTCAGGGAGAGGAGGG - Intronic
1105379113 13:19870473-19870495 AAGGGAAAGGAGGGGAAGGAAGG - Intergenic
1105705012 13:22963210-22963232 AAGGGGAAGGAGGGGAAGGAGGG + Intergenic
1105857969 13:24388388-24388410 AAGGGGAAGGAGGGGAAGGAGGG + Intergenic
1106346420 13:28883664-28883686 AAGGGGTAGCAGGAGGAGGCAGG + Intronic
1106928878 13:34641819-34641841 AAGAGAAAGCAGGCGCAGGGTGG + Intergenic
1107092144 13:36493349-36493371 AAGGTTCAGCAGGCTGAGGCAGG + Intergenic
1107614515 13:42151003-42151025 AAGGGGCTGCAAGCGGAGGAAGG + Intronic
1108212455 13:48152063-48152085 AATGGAAAACAGGAGGAGGAGGG + Intergenic
1109143194 13:58743048-58743070 AAGGCTAGGCAGGTGTAGGAAGG - Intergenic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1113669445 13:112165747-112165769 GAGGGGGAGGAGGCGGAGGAGGG - Intergenic
1114219080 14:20681386-20681408 AAGGGAAAACCGGCAGAGGAAGG - Intergenic
1114368111 14:22052528-22052550 AAGGATAAGCAGGCCCAAGAGGG - Intergenic
1114958411 14:27851247-27851269 AATGGAAAGCAGGCAAAGGAGGG + Intergenic
1115688505 14:35821277-35821299 AAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118309682 14:64683227-64683249 AACGGGAAGCAGGCCGAGGTGGG - Intergenic
1118459564 14:65976066-65976088 AGGGGGAAGGAGGAGGAGGAGGG + Intronic
1119039974 14:71264727-71264749 AAGGGAAAGAAAGCTGAGGAAGG - Intergenic
1119449698 14:74698731-74698753 ATGAGTAAGCAGGCTGAGCATGG + Intronic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1122678704 14:103439245-103439267 AAGGGGAATCAGGTTGAGGAGGG - Intronic
1123964172 15:25438823-25438845 AAGCGTAAGTAGGCGGCGGATGG + Exonic
1124957730 15:34370763-34370785 AAGGGAAAGGAGGAGGAAGAAGG - Intergenic
1125402385 15:39318010-39318032 AAAGGTAAGGAGGAGGAGGAGGG - Intergenic
1125610518 15:40966285-40966307 GCGGGTCAGCAGGCGGAGGAAGG + Intergenic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1127267846 15:57376098-57376120 AAGGCTAAGCAGGGAAAGGAAGG + Intronic
1127996568 15:64156375-64156397 AAGGGTGAGGAGGAGGAAGAGGG + Exonic
1128072559 15:64806836-64806858 AGAGGAAGGCAGGCGGAGGAAGG + Intergenic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128338411 15:66803143-66803165 ATGGGGAGGCAGGGGGAGGAGGG - Intergenic
1128390762 15:67180939-67180961 AAGGCCAAGCAGGCGGGGCAGGG + Intronic
1128576059 15:68775950-68775972 AAGGGTGAGCAGGCCAAGGAGGG - Intergenic
1128733597 15:70036954-70036976 GAGGGTCAGCAGGTGGAGGGAGG - Intergenic
1129281731 15:74490300-74490322 CAGGGTGAGCAGCCGGAAGAGGG - Intergenic
1129338110 15:74866158-74866180 AAGTGAAAACAGGCTGAGGAAGG + Intronic
1130231881 15:82103411-82103433 TAGAGAAAGCAGGCAGAGGATGG + Intergenic
1131017857 15:89072512-89072534 AAGGATGAGCAGGAGGGGGAGGG + Intergenic
1132580046 16:680529-680551 AAGGGCAAGGAGGAGAAGGAGGG + Exonic
1132934390 16:2473559-2473581 AAGGGGAAGCTGGCGGAGGAGGG - Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134657302 16:15956797-15956819 GAGGCTAAGGAGGAGGAGGAAGG + Intronic
1136062333 16:27735218-27735240 AGAGGGAAGCAGGCGGAGGCAGG - Intronic
1136228412 16:28873588-28873610 AAGAGAAAGCGGGCGGTGGAGGG + Exonic
1136537309 16:30907598-30907620 CAGGGTCAGCAGGCAGAGGCGGG + Intergenic
1137616448 16:49850704-49850726 GAAAGTAAGCAGGCAGAGGATGG - Intronic
1138217369 16:55215950-55215972 AAAGATATGCAGTCGGAGGAAGG - Intergenic
1138287394 16:55820797-55820819 TAGGGGAGGCAGGCAGAGGAAGG - Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139990934 16:70938811-70938833 CAGCCTAAGCAGGCGGAGTAGGG + Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141083737 16:81076910-81076932 AAGGGTGGGTAGACGGAGGACGG - Intronic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141845112 16:86603358-86603380 AGGGGGAAGGAGGAGGAGGAAGG - Intergenic
1141970858 16:87481553-87481575 AAGGGTAAGCGGGAGGGGAAAGG + Intronic
1142240446 16:88942179-88942201 AAGGCAAAGCGGGCGGGGGAGGG - Intronic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142887294 17:2920645-2920667 AGGAGGAAGCAGGCGGACGAGGG + Intronic
1143262937 17:5613865-5613887 AAGGAAAAGCAGGAGGAAGAGGG + Intronic
1143462914 17:7115231-7115253 AAGCTTCAGCAGGAGGAGGAAGG + Intronic
1144207456 17:12989122-12989144 AAAACTAAGCAGGCGGAGGAAGG + Intronic
1148480898 17:47958804-47958826 AAGGGCAAGAAGGCAGGGGATGG + Intergenic
1149712560 17:58756277-58756299 GAGGGTGAGGAGGAGGAGGAGGG + Exonic
1151163846 17:72187782-72187804 CAGGGTGAGCAGGCGGGGGAAGG - Intergenic
1152000090 17:77639931-77639953 AAGAGGAAGAAGGAGGAGGAGGG - Intergenic
1152496976 17:80680094-80680116 AAGAGCCAGCAGGCTGAGGAGGG - Intronic
1153524440 18:5980934-5980956 AAGGCTAGTGAGGCGGAGGATGG + Intronic
1153642096 18:7166006-7166028 AAGGCAATGCAGGCGGAGGTTGG + Intergenic
1153700821 18:7691967-7691989 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700830 18:7692001-7692023 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700839 18:7692035-7692057 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700848 18:7692069-7692091 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700857 18:7692103-7692125 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700866 18:7692137-7692159 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700875 18:7692171-7692193 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700884 18:7692205-7692227 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700893 18:7692239-7692261 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700902 18:7692273-7692295 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700911 18:7692307-7692329 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700920 18:7692341-7692363 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700929 18:7692375-7692397 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1155166248 18:23234749-23234771 AAGGGTCAGGAAGCAGAGGAGGG + Intronic
1156346295 18:36259996-36260018 AAGAGTAAGTAGGGGGAGGATGG - Intronic
1157030493 18:43900972-43900994 AAGGCTAAGGAAGAGGAGGAAGG - Intergenic
1157215644 18:45781034-45781056 AAGGGAAAGGAGGTAGAGGATGG - Intergenic
1158082940 18:53615728-53615750 CAGGGTAAGCAGGCTGTGGTTGG - Intergenic
1158575029 18:58629498-58629520 GGGGGTAAGCAGGGTGAGGAGGG - Intergenic
1159060357 18:63508147-63508169 AGGGGTGAGCTGGGGGAGGAGGG + Intergenic
1159936897 18:74376192-74376214 ATGGGCAAGCAGGTGGATGATGG + Intergenic
1161520983 19:4723471-4723493 GAGGGAAAGAAGGTGGAGGAGGG + Intronic
1162416762 19:10543380-10543402 AGGGGTAGGCAGGCGCGGGAGGG - Intergenic
1163779166 19:19237197-19237219 AAGGAAAAGTAGGCTGAGGATGG - Intronic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1165826710 19:38709772-38709794 AAGGGCAAGGTGGCTGAGGAGGG + Intronic
1166144411 19:40824247-40824269 AAGACTAAGCAGGTGGAGGCGGG + Intronic
1166316973 19:41994548-41994570 AAGGGTACGCTGGGGGAGGGGGG + Intronic
1166922109 19:46235979-46236001 TAGGGTAAGAAGGCAGACGAAGG - Intergenic
1167175310 19:47860610-47860632 AGGGGAAAGTAGGGGGAGGAGGG - Intergenic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214236 19:48153871-48153893 AAGAGGAAGAAGGAGGAGGAAGG - Exonic
1167733641 19:51277932-51277954 CTGAGTAAACAGGCGGAGGAAGG + Intergenic
1168105035 19:54161252-54161274 GAGGGTAAGCTGGTGGGGGAAGG + Exonic
1168231769 19:55037115-55037137 AAGGCTAAGCAGGAAGAAGATGG - Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
925606638 2:5666945-5666967 AGGGCTGAGCAGGGGGAGGAGGG - Intergenic
925847900 2:8050462-8050484 AAGCCCAAGCAGGCTGAGGAGGG - Intergenic
926105444 2:10146721-10146743 AAGGGTAGGGAGGAGGAGGAGGG + Intronic
926686546 2:15702813-15702835 CAGGGTAAGCAGGCTTAGAATGG - Intronic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
926843695 2:17110053-17110075 AAGGTTAACTAGGCTGAGGATGG + Intergenic
927692846 2:25220490-25220512 GATGGGAAGCAGGCAGAGGAGGG + Intergenic
927932953 2:27057387-27057409 AGGGGAAAGCCGGCGGGGGAGGG - Exonic
927949608 2:27158807-27158829 GAGGGAGAGCAGGCGGAAGAGGG + Intergenic
928370602 2:30737450-30737472 AGGGGTACGCAGGAAGAGGATGG + Intronic
929691286 2:44076089-44076111 CAGGGTGAGCAGGCTGGGGAGGG + Intergenic
929778265 2:44941960-44941982 AGGGGGGAGCAGGAGGAGGAGGG - Exonic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931625164 2:64250719-64250741 ATGGGAAAGCCGGGGGAGGAAGG + Intergenic
932450886 2:71810169-71810191 AAGGGAAAGAAAGAGGAGGAGGG + Intergenic
932566465 2:72914364-72914386 AAAGGTAAGCAGCCTGAAGATGG + Intergenic
933525395 2:83431720-83431742 AAGGGTAAGCAGGCTGAATTGGG - Intergenic
934036025 2:88088955-88088977 GAAGGTGAGCAGGCTGAGGACGG + Intronic
934557392 2:95294675-95294697 AAGGTTAAGGAGGCTGTGGAAGG - Intergenic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
934883491 2:98004688-98004710 AAGGGAGAGGAGGAGGAGGAGGG - Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935885707 2:107617142-107617164 AAGGGTACCCAGGTAGAGGATGG + Intergenic
935946955 2:108295384-108295406 ATGGTTAAGCAGGCAGAGGCTGG - Intronic
937952912 2:127402009-127402031 AAGGGAAGGCAGGCTGAGGTGGG - Intergenic
938000829 2:127735259-127735281 AGGGGTGATCAGGTGGAGGAGGG - Intronic
938092191 2:128441213-128441235 AAGGGTAGGCAGGCAGGGCAGGG - Intergenic
938095116 2:128456516-128456538 AAGGGGAGGCAGGGGGATGAGGG - Intergenic
938179581 2:129168458-129168480 AAGGGTAGGCAGGCAGAGTGAGG - Intergenic
940439136 2:153693632-153693654 AAGGGCAAGCAGGAGGATAAGGG + Intergenic
940879186 2:158929449-158929471 AAGGATGAGCAGGAGGAGGAAGG - Intergenic
943483072 2:188446252-188446274 AAGAGTAATCATGTGGAGGATGG + Intronic
944124214 2:196275103-196275125 AAGGACAAGCAAGCGGTGGAGGG - Intronic
944604836 2:201343423-201343445 AATAGTTGGCAGGCGGAGGAGGG + Intronic
946085041 2:217162433-217162455 AAAGGGAAGCAGGAGGATGAAGG + Intergenic
946130374 2:217601855-217601877 AAGGCTGAGCAGGTTGAGGAGGG + Intronic
946130407 2:217602135-217602157 AAGGCTGAGCAGGTTGAGGAGGG - Intronic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
946973382 2:225120515-225120537 CAGGGTAGGCAGGCAGAGGAAGG - Intergenic
947047882 2:226008851-226008873 AAGGAAGAGCAGACGGAGGAGGG + Intergenic
947232634 2:227903373-227903395 AAAGGAAAGCAGGTGGAGGCTGG + Intronic
947574058 2:231258475-231258497 AAGAGTAAGCAGTCGGGGGCCGG - Intronic
948375737 2:237519199-237519221 AAGGGGAAGCAGCTGGAAGAAGG + Intronic
1168904345 20:1391813-1391835 AAGGGGAAGGAGGAGGGGGAGGG + Intronic
1169074119 20:2751028-2751050 AAGGGGAAGGAGGAGGAGAAGGG + Intronic
1169586590 20:7092570-7092592 AAGGGTTTTCAGGCTGAGGAAGG - Intergenic
1169765581 20:9144674-9144696 AGGGGGAAGGAGGGGGAGGAGGG + Intronic
1169765595 20:9144710-9144732 AAGGGGAAGAAGGGGAAGGAGGG + Intronic
1169765599 20:9144719-9144741 AAGGGGAAGGAGGGGAAGGAGGG + Intronic
1169935685 20:10880862-10880884 ACGAGTATGCAGACGGAGGAGGG + Intergenic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1171085830 20:22237438-22237460 AAGGGGAAGGAGGAGGAGCAGGG - Intergenic
1171464615 20:25318959-25318981 AAGGGAAAGCAGGCCTAGGTGGG - Intronic
1171868152 20:30505616-30505638 AGGGGGGAGCAGGGGGAGGAAGG - Intergenic
1173108445 20:40161156-40161178 AAGGGTAAGGAGGCTGAGATAGG + Intergenic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1174052089 20:47773997-47774019 AGGGGCAAGCTGGCTGAGGACGG - Intronic
1174450746 20:50618591-50618613 CAGGGTAAGCAGGCAGAGGCAGG - Intronic
1174850151 20:53986202-53986224 AGAGGGAAGGAGGCGGAGGAAGG - Intronic
1175723385 20:61300855-61300877 AAGGGTGAGGAGGAGGAGGTGGG - Intronic
1175807505 20:61838011-61838033 AACGGTGAGCAGGCAGAGAAAGG - Intronic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1175893376 20:62325101-62325123 AGGGGCAGGCAGGCGGACGAGGG + Intronic
1176282747 20:64323915-64323937 AAGGGTAGTGAGGCAGAGGAGGG + Intergenic
1177282140 21:18994472-18994494 AAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1178291157 21:31369741-31369763 AAGGGTTAGGAGGCTGAGGCGGG + Intronic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1180150462 21:45944577-45944599 AGGTGTAAGAAGGCGCAGGATGG - Intergenic
1181456662 22:23063799-23063821 AAGGGGAAGCAGGCCCAGGGTGG + Intronic
1182844835 22:33421834-33421856 GGGGGTAAGCAGGTGGAAGAGGG + Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1184375827 22:44112027-44112049 GAGTGGAAGCAGGCAGAGGAGGG + Intronic
1184597536 22:45523281-45523303 AAGGGTAACCAGGTGGCTGAGGG + Intronic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
949465387 3:4338161-4338183 AAGGTGAAGCAGGCGGAGGATGG + Intronic
949903294 3:8837713-8837735 AAGGGTAAGCAGGTTTAAGATGG + Intronic
950580417 3:13858334-13858356 AAGGGGCAGGAGGCAGAGGAGGG + Intronic
950769945 3:15303314-15303336 AAGCCGAAGCAGGCTGAGGAAGG + Intronic
951149964 3:19277197-19277219 AAGGGGAGGCAGGGGGATGAAGG + Intronic
952301302 3:32106642-32106664 AAGGCTGAACAGGCGGAGGTGGG + Exonic
954336846 3:49923375-49923397 AAGGGGAAGGAGGGGAAGGAGGG + Intronic
954370180 3:50166103-50166125 AAGGGGGAGTAGGGGGAGGAAGG - Intronic
954432945 3:50480907-50480929 AAGGGGAGGAAGGGGGAGGAAGG + Intronic
954435505 3:50493800-50493822 AAGGGCAGGGAGCCGGAGGAGGG + Intronic
955143013 3:56288316-56288338 AAGGTAAAGCAGGAGGATGAGGG + Intronic
955229660 3:57087413-57087435 TAAGCTAAGCAGGTGGAGGAGGG - Intergenic
956223755 3:66933369-66933391 AAGGGACTGCAGGGGGAGGATGG - Intergenic
957167991 3:76699803-76699825 AAGAGGAAACAGGGGGAGGAAGG - Intronic
957386704 3:79505302-79505324 AAGAGGAAGCAGGTTGAGGAAGG + Intronic
959942698 3:112096075-112096097 AAGGGTAAGCAGGCAATGAATGG - Intronic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
962415333 3:135176968-135176990 AAGAGGAAGCAAGCGGAGGGTGG - Intronic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
964537935 3:157746096-157746118 TAGGGTGAGAAGGAGGAGGAAGG + Intergenic
965000624 3:162948000-162948022 AAGGCAAAGCAGGCAGAAGAAGG - Intergenic
966253189 3:177889666-177889688 AATGGGAAGCAGTCAGAGGAGGG + Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966568641 3:181413423-181413445 AAGGGCAAGCAGAGGAAGGAAGG + Intergenic
968236108 3:197030611-197030633 AAGGAGAAACAGGCGGAGAAGGG + Intergenic
968719603 4:2191330-2191352 AAGGGTAAGGGGGCGGTGGGTGG + Intronic
968943924 4:3653768-3653790 GAGGGCAGGCAGGCAGAGGAAGG - Intergenic
969246648 4:5938906-5938928 AAGCATGAGCAGGCAGAGGAAGG - Intronic
969689109 4:8694554-8694576 CAGGGAGAGCAGGTGGAGGAAGG + Intergenic
970155469 4:13137261-13137283 AAGGGTCTGCAGGTTGAGGAAGG + Intergenic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
970974208 4:22024250-22024272 AAGGGTAATCAGTCAGAGAAAGG + Intergenic
971266584 4:25101226-25101248 AAGGGTGAGGAGGTGGAAGAGGG - Intergenic
972247275 4:37258662-37258684 GAGTGTCAGCAGGTGGAGGAAGG + Intronic
972374757 4:38459984-38460006 TAGGGTAAGCAGGGGGACCAGGG - Intergenic
972428408 4:38956794-38956816 ATGGGGAAGCAGGCGCAGTAGGG - Intergenic
973284122 4:48396262-48396284 AAGGTAAAGAAGGGGGAGGAGGG + Intronic
974330036 4:60466425-60466447 CAGGGTAATCAGGCAGAAGAAGG + Intergenic
974699530 4:65422440-65422462 AAGGTTGAGCAGGCAGAGAATGG - Intronic
976223493 4:82777277-82777299 AAGGGAGAGTAGGCCGAGGAGGG - Intronic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
981471820 4:145144335-145144357 AAAAGGAAGCAGGCGGAGAATGG - Exonic
982136912 4:152280983-152281005 AAGGGACAGCAGGCAGAGGGTGG - Intergenic
985250810 4:188022594-188022616 AAAGTTTAGCAGGAGGAGGAAGG + Intergenic
985309164 4:188578130-188578152 AAGCCTAAGGAGGCGGAGTATGG - Intergenic
985355370 4:189113623-189113645 AAGGGTACACATGCGTAGGAAGG - Intergenic
985783757 5:1883772-1883794 AGGGGGAAGCCGGCGGAGCACGG - Intronic
985823696 5:2178150-2178172 AAGGGCAGGCAGGCGGATCACGG - Intergenic
987234786 5:15931804-15931826 GAGGGGCAGCAGGCAGAGGAGGG - Intronic
987785037 5:22488733-22488755 CAGGGTAAGCAGGTTTAGGATGG - Intronic
989383186 5:40829477-40829499 AATGGTAACCAGTCAGAGGAGGG - Exonic
989446501 5:41535913-41535935 AAGGGCAATCAGGCAGTGGAAGG - Intergenic
989843275 5:46108218-46108240 CAGGGTAATCAGGCAGAAGAAGG - Intergenic
990358503 5:54995145-54995167 AAGATTAAGCAGGTGGATGAAGG - Intronic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
992808353 5:80360896-80360918 AAGGTTAGGCAGGCAGAGGAGGG - Intergenic
993077647 5:83254381-83254403 AAGGGTAATGAGGAGGAGGGTGG - Intronic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
995321508 5:110839637-110839659 AAGGGAAAGAAGGAAGAGGAAGG - Intergenic
996671872 5:126127505-126127527 ATGGGGAAGGAGTCGGAGGAGGG - Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
999554271 5:152723162-152723184 AAGGTTTAGAAGGTGGAGGAAGG - Intergenic
999820993 5:155228583-155228605 CAGAGTAAGCAAGCGGAGAATGG + Intergenic
1000091068 5:157930100-157930122 GAGGGGAAGAAGGGGGAGGAAGG + Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001081832 5:168672920-168672942 AAGGGTGAGAAGGGGGAGGCAGG - Intronic
1001672679 5:173487135-173487157 GAGGGTAAGCAGGCTCAGAATGG - Intergenic
1001689822 5:173624727-173624749 CCGGGTAAGTAGGTGGAGGAAGG + Intergenic
1002065174 5:176648124-176648146 AAGGGAAAGGAGGCCGGGGAAGG - Intronic
1002437160 5:179238652-179238674 AAGGGCAAGGAGGCCCAGGATGG + Intronic
1002512430 5:179731694-179731716 AAGGTTAAGCAGGAGGTGGCAGG - Intergenic
1002924290 6:1595833-1595855 GAGGGTGGGAAGGCGGAGGAGGG - Intergenic
1003558121 6:7158551-7158573 AAGGGTATGGAGGTGGAGGCTGG - Intronic
1005882013 6:30069252-30069274 AAGGGTCAGGAGGCTGGGGAGGG - Exonic
1005882116 6:30069821-30069843 AAGGGTTAGCAGGAGGAGAAGGG - Exonic
1006303605 6:33206870-33206892 AAGGGAAAGGAGGGGGAGGTGGG - Intergenic
1006376931 6:33676888-33676910 AAGGGTGAGGAGGTGGAGGCAGG + Exonic
1006442015 6:34058895-34058917 AAGGGGAAGGAAGCCGAGGAGGG + Intronic
1006735067 6:36267710-36267732 AAGGGTAAGCAGGCGGAGGAGGG - Intronic
1007485706 6:42179207-42179229 AAAGGGAATCAGGGGGAGGAGGG - Intronic
1007684286 6:43656028-43656050 AAGGGAAAGAAGGGGAAGGAAGG - Intronic
1007692108 6:43709129-43709151 GAGGGGAAGGAGGGGGAGGAGGG - Intergenic
1008863233 6:56176903-56176925 AAGGGGAGGAAGGGGGAGGAAGG + Intronic
1010498328 6:76563602-76563624 AAGGGTAAGGAGGTAGAAGAAGG - Intergenic
1010510213 6:76709000-76709022 AATGGGAACCAGGCAGAGGAAGG + Intergenic
1011935018 6:92765967-92765989 AAGGGTGAGTATGCAGAGGAGGG - Intergenic
1015241074 6:131024214-131024236 AAGAGAAAGCAGGCAGAGGGAGG + Intronic
1015398204 6:132758945-132758967 AAGGAGAAGTAGGGGGAGGATGG - Intronic
1015849004 6:137552410-137552432 AAGGGAAGGAAGGGGGAGGAAGG - Intergenic
1017143662 6:151214719-151214741 AAGGGTATGCAGGTGGAAAAGGG + Intergenic
1018918382 6:168152829-168152851 CTCGGTAAGCAGGCCGAGGATGG - Intergenic
1019504289 7:1383093-1383115 AAGGGTAAGAAAGCAGAGAAGGG + Intergenic
1019880607 7:3857279-3857301 AAGGGGAAGGAGGAGGAGAAAGG + Intronic
1020164955 7:5800495-5800517 AAAGGTAAGGAGGCAGAGGCAGG - Intergenic
1020448161 7:8291992-8292014 CAGGGTAAGCAGGCCCAGGCTGG - Intergenic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1022012053 7:26316708-26316730 GAGGGTAAGCAGGTGGACCAGGG + Intronic
1022025571 7:26444716-26444738 AAGGGTAAGTAGGTGTAGGCTGG - Intergenic
1022426718 7:30276319-30276341 AAAGGCAAGAAGGCGGAGGTTGG - Intergenic
1023556585 7:41429874-41429896 AAGAGTAGGCTGGAGGAGGAGGG - Intergenic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878835 7:44307296-44307318 GGGTGTGAGCAGGCGGAGGAGGG + Intronic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1024171357 7:46791147-46791169 AAGGGAAAGCAAGAGAAGGAAGG + Intergenic
1024283625 7:47738914-47738936 AAGGGGCAGCAGGTGGGGGAGGG - Intronic
1024959747 7:54961597-54961619 AAGTGTAAGCAGGCTGGGCATGG + Intergenic
1025828514 7:65030445-65030467 AAGAGGAAGAAGGAGGAGGAGGG + Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026639621 7:72112958-72112980 AAGGGTAAACAGGCAGGGGTGGG + Intronic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026806125 7:73430450-73430472 AAGGGGATGGAGGGGGAGGAGGG - Intergenic
1026806137 7:73430474-73430496 AAGGGGAGGGAGGGGGAGGAGGG - Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1028193362 7:87876788-87876810 AAGGGACTGCAGGCGGAGGAGGG - Intronic
1028248258 7:88508995-88509017 AAGGCCAAGCAGGATGAGGAAGG - Intergenic
1030170610 7:106599156-106599178 CAGGGTAGGCAGGGAGAGGAAGG - Intergenic
1030627163 7:111856737-111856759 ACGGGTAAGCGGGAAGAGGAGGG + Intronic
1031868051 7:127061610-127061632 AAGCATCAGCAGGGGGAGGAAGG - Intronic
1032410738 7:131692023-131692045 AAAGGAGAGCAGGGGGAGGAGGG - Intergenic
1033595227 7:142854552-142854574 AAGGAAAAGCAGGGGGTGGAGGG - Intergenic
1033599516 7:142878536-142878558 AAGGTTGAGTAGGCAGAGGATGG - Intronic
1034096277 7:148410779-148410801 AAAGTTGAGCAGGAGGAGGAAGG + Intronic
1034941350 7:155232331-155232353 AAGGGAGAGGAGTCGGAGGAAGG + Intergenic
1035679881 8:1480172-1480194 AAAGCTCAGCAGGCGGAGGGGGG - Intergenic
1036053095 8:5222054-5222076 TAGGGTGAGGAGGAGGAGGAAGG + Intergenic
1036727154 8:11230444-11230466 AGGAGTTAGCAGGCAGAGGAAGG + Intergenic
1037425031 8:18746315-18746337 AAGGGTCAGCAGGGGAGGGAGGG - Intronic
1037635104 8:20694554-20694576 AGGGGTGAGCAGGAGGAGAAAGG - Intergenic
1037901190 8:22690540-22690562 AAGGAGAAGAAGGCGGAGAAGGG - Exonic
1038311601 8:26449646-26449668 AGGGGTGAGCAGGAGGAGGGAGG + Intronic
1038611376 8:29062674-29062696 AAGGGAAGGCAGGCTGACGAAGG + Intronic
1038696872 8:29813996-29814018 AAGGCAAAGCAGGCTGAGCATGG + Intergenic
1041746160 8:61211358-61211380 AAGGGAAAGAAGGAGAAGGAGGG - Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042841831 8:73131785-73131807 AAGGGGAAGAAGGGGGGGGAAGG - Intergenic
1043079690 8:75750719-75750741 AAGGAGAAGCAGGCGAAGGATGG - Intergenic
1044021617 8:87112148-87112170 AAGAGTGAGCAGGCAGATGATGG - Intronic
1044953093 8:97452484-97452506 AATGGTCAGCAGGATGAGGATGG + Intergenic
1045015069 8:97994240-97994262 AAGGGAAAGAGGGAGGAGGAGGG + Intronic
1046063243 8:109164273-109164295 AAGGGGAAGAAAGGGGAGGAGGG + Intergenic
1046680345 8:117162550-117162572 ATGGGTTAGCAGGCAGAGAATGG + Intronic
1049315837 8:141966886-141966908 AAGGGCAAGTAGGCGGAGCTGGG + Intergenic
1049405954 8:142451955-142451977 AAGGTCAAGCAGGCGAAGGAGGG + Intronic
1049533931 8:143169361-143169383 GAGGGTAAGCAGTAGGATGATGG - Intergenic
1049554467 8:143275171-143275193 TAGGGGATGCAGGAGGAGGAGGG - Intronic
1050284246 9:4084588-4084610 AAGGCTGAGCAGCCGAAGGATGG + Intronic
1051583979 9:18707144-18707166 AATGATAAGCAGGAGGAGGAGGG + Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1054752551 9:68922606-68922628 AAGGGAAAGGAGGTGGATGAAGG - Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055446984 9:76393950-76393972 AAGGGGATGCGGGAGGAGGAAGG + Intronic
1055599471 9:77900739-77900761 AAGGGTAAGTAAGTGGAGAATGG - Intronic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1057645784 9:96874450-96874472 AGAGGTAAGCAGGCAGAGGGTGG - Intronic
1057748857 9:97773764-97773786 AAAGGTAAGCAGGGGCAGGTAGG - Intergenic
1057758124 9:97853204-97853226 GAGGGGAAGCCGGCGGAGGGAGG + Intergenic
1061536761 9:131255115-131255137 AAGGGTCAGCAGTGGCAGGAAGG + Intergenic
1061636873 9:131917009-131917031 AAGGGGCAGCAGGTGGAGAAGGG + Intronic
1061656465 9:132095034-132095056 AAAGGAAAGCAGGCAGAAGAAGG - Intergenic
1062469707 9:136697013-136697035 AGGGGGAAGGAGGAGGAGGAGGG - Intergenic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1185608429 X:1380436-1380458 AAGGGGAAGAGGGGGGAGGAGGG + Intronic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1187817355 X:23247205-23247227 AAGAGAAAGTAGGGGGAGGAAGG - Intergenic
1188874823 X:35416848-35416870 AAGGGTCACCAGGCAGAGTAGGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1190122285 X:47672172-47672194 AAGGGGAAGCATGAGTAGGAAGG - Intergenic
1190735107 X:53250788-53250810 AATGGTAAGCAGGGGAAGGTGGG + Exonic
1190762445 X:53447854-53447876 AAGGGAATGCAGGAGGAAGAGGG - Intergenic
1191850572 X:65582930-65582952 AAGGGAGAGCAGGAGGGGGAGGG + Intergenic
1192175346 X:68881492-68881514 AAGGGTAAGCAGGGAGAGGTGGG - Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1194147629 X:90282326-90282348 AAGAGTCAGCAGACAGAGGAAGG + Intergenic
1195557220 X:106240876-106240898 AAGGGAGAGTAGGGGGAGGAGGG + Intergenic
1195986283 X:110634154-110634176 AAGGGAAATCAGGGGGTGGAGGG + Intergenic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1198264643 X:134998114-134998136 AAGGGTAAGCAGGGGGAAAATGG - Intergenic
1198483650 X:137064862-137064884 AAGGTTAAGCAGTAGGAAGAGGG - Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198804567 X:140481208-140481230 TAGGGGATGCAGGCTGAGGAGGG - Intergenic
1199034385 X:143033173-143033195 AAGGGTAAGGAAGCAGAGGATGG + Intronic
1199321172 X:146440990-146441012 AAGAGAAAACAGGGGGAGGAAGG + Intergenic
1199737446 X:150696883-150696905 AAGTGGGAGCAGGTGGAGGAAGG + Intronic
1201549927 Y:15209215-15209237 AAGGGGGAGCAGGGAGAGGAGGG + Intergenic