ID: 1006736297

View in Genome Browser
Species Human (GRCh38)
Location 6:36275747-36275769
Sequence TTTCACATGGGGCAAAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 657
Summary {0: 1, 1: 0, 2: 5, 3: 94, 4: 557}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006736297 Original CRISPR TTTCACATGGGGCAAAGAAA GGG (reversed) Intronic
901448802 1:9323902-9323924 TTTCCCATGGGCCACAGAGAGGG - Intronic
904495613 1:30884693-30884715 TTGCAAATGGGGCAAAGGAAAGG - Intronic
904937708 1:34143452-34143474 TTTAACACGGGGCAAGGAGAGGG - Intronic
906833806 1:49061397-49061419 TTTCACATGGAGCAATGGACTGG - Intronic
907117132 1:51978792-51978814 TTTCCCCAAGGGCAAAGAAAGGG + Intronic
907292341 1:53424825-53424847 TTTTTCATGGAGCAAAGAACAGG - Intergenic
907503872 1:54903106-54903128 TTTCTCATGGAGCAAAGAACAGG + Intergenic
907520984 1:55023227-55023249 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
907554491 1:55332947-55332969 TCTCACATGGGGAAAACACACGG - Intergenic
907647799 1:56261604-56261626 GTTCACATGGGACACAGAGATGG + Intergenic
908460336 1:64342702-64342724 TTTCACATGGTCCAATGTAAGGG + Intergenic
908462006 1:64355237-64355259 TTTCTCATGGAGCAAAGAACAGG + Intergenic
908592346 1:65647522-65647544 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
909776952 1:79493628-79493650 TTTCTCACGGAGCAAAGAACAGG + Intergenic
909804050 1:79852578-79852600 TTTCACATGGAGCAGAAGAATGG + Intergenic
909909643 1:81245792-81245814 TTTCTCATGGAGCAAAGAACAGG - Intergenic
909973420 1:82018258-82018280 TTTCATTTGGGGAAGAGAAAAGG - Intergenic
909978729 1:82072651-82072673 TTTCTCATGGAGCAAAGAACAGG + Intergenic
910003023 1:82360080-82360102 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
910683527 1:89892128-89892150 CTTCATATGGGGCAAACATATGG - Intronic
910945114 1:92582618-92582640 TTTAAAATGGGTCAGAGAAATGG + Intronic
911510873 1:98806334-98806356 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
911570087 1:99510022-99510044 TTTCTCATGGAGCAAAGAACAGG - Intergenic
911767330 1:101693562-101693584 TTTTACTGGGGGAAAAGAAAAGG + Intergenic
911866579 1:103033037-103033059 TTTTACAAGGGGCCAGGAAAAGG - Intronic
912815572 1:112825580-112825602 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
913987301 1:143576495-143576517 TTTTGCTTGGGGGAAAGAAAGGG + Intergenic
916183913 1:162112559-162112581 TTCCTCATGGTGCAAAGAACTGG - Intronic
916941541 1:169683536-169683558 TTTCTCATGGAGCAAAGAGCAGG - Intronic
917049771 1:170907550-170907572 TTTCTTATTGGACAAAGAAATGG - Intergenic
917241258 1:172951032-172951054 TATCACATGGAGCAGAGACATGG - Intergenic
918346704 1:183613700-183613722 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
919360532 1:196588051-196588073 TATCAGCTGAGGCAAAGAAAGGG + Intronic
920829069 1:209449315-209449337 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
920901761 1:210115767-210115789 TTTCTCATGGAGCAAAGAGCAGG + Intronic
921347198 1:214198448-214198470 TTTCTCATAGGGCAAGGAAGGGG + Intergenic
921435609 1:215116951-215116973 TTTCATGTGGAGAAAAGAAATGG - Intronic
921460075 1:215415154-215415176 TTTCTCACGGAGCAAAGAACAGG + Intergenic
921733402 1:218599554-218599576 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
922049858 1:221978428-221978450 TTTCTCACGGAGCAAAGAACAGG + Intergenic
923244451 1:232118624-232118646 TTTCTCATGGAGCAAAGAACAGG - Intergenic
923257569 1:232234469-232234491 TTTCTCATGGAGCAAAGAACAGG + Intergenic
923408942 1:233688666-233688688 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
923771019 1:236937413-236937435 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
923791851 1:237118305-237118327 TGTCACATGGGATACAGAAAAGG - Intronic
923912742 1:238467258-238467280 TTTCACATGAGTAAAATAAAGGG + Intergenic
924106828 1:240657360-240657382 TTGGACATGGGGAAAAGCAAAGG - Intergenic
924501691 1:244644236-244644258 TTTGACAAGGAGCAAAGAAATGG + Intergenic
924896316 1:248340617-248340639 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1064173739 10:13056291-13056313 TTACAGATGGGGCCTAGAAATGG + Intronic
1065443471 10:25774355-25774377 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1065610291 10:27465820-27465842 TTTCTCATGGAGCAAAGAACAGG - Intergenic
1065703113 10:28444537-28444559 CTTAAGATGGGGCAAATAAATGG + Intergenic
1066018830 10:31276250-31276272 TTTTAAATGGGGCAAAGATGTGG + Intergenic
1066050462 10:31630719-31630741 TTTTACATGGTGCAAGGTAAAGG + Intergenic
1066226176 10:33385908-33385930 TTAAAAATGGGGCAAAGAAATGG - Intergenic
1066477412 10:35761355-35761377 TTTAACAGGGAGCAAAGAGATGG - Intergenic
1067044507 10:42976666-42976688 TTGCACATGTGGCACAGAGACGG + Intergenic
1067721416 10:48730360-48730382 TAACACATGGGGCACAGACATGG + Intronic
1068058642 10:52039032-52039054 TTTCTCGTGGAGCAAAGAACAGG + Intronic
1068207122 10:53870020-53870042 TATCACATTTGGAAAAGAAAAGG + Intronic
1068230661 10:54167185-54167207 TTTCTCAGGGAGCAAAGAACAGG - Intronic
1068360555 10:55971957-55971979 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1068550344 10:58400944-58400966 TTTCAAAATGGGCAAAGAACTGG - Intergenic
1068592709 10:58866800-58866822 TTTCTCACGGAGCAAAGAACAGG + Intergenic
1068735318 10:60407720-60407742 TTTCACATAGGGCTCAGAAATGG + Intronic
1068993053 10:63170845-63170867 AGTCAAATGTGGCAAAGAAAAGG - Intronic
1069305602 10:66965114-66965136 TTTGGCATGGGACAAAGAACAGG - Intronic
1071133539 10:82425465-82425487 GTTCTAATGGGGAAAAGAAAAGG - Intronic
1071185818 10:83043470-83043492 TTTAACATGGAAAAAAGAAAAGG - Intergenic
1071546589 10:86534608-86534630 TGGCCCTTGGGGCAAAGAAAAGG + Intergenic
1072534472 10:96351377-96351399 TGTCACAGGTGGGAAAGAAACGG - Exonic
1073394344 10:103205928-103205950 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1073847656 10:107576967-107576989 TGTCAGATGTGGCAAAGATATGG + Intergenic
1073933141 10:108599520-108599542 TTTCTCACGGAGCAAAGAACAGG - Intergenic
1074528837 10:114282942-114282964 TTTCACATGGAGGAGGGAAATGG - Intronic
1075595066 10:123723297-123723319 TTTCCCTTGGGGCTAGGAAAAGG - Intronic
1076373458 10:129968828-129968850 TGGCACATGGGGCAAACCAACGG + Intergenic
1078046422 11:7917387-7917409 TTTCTCATGGAGCAAAGAACAGG + Intergenic
1079163417 11:18014256-18014278 TTACACATGCTTCAAAGAAATGG - Intergenic
1079672872 11:23189212-23189234 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1080028230 11:27634398-27634420 TTTCTCACGGAGCAAAGAACAGG + Intergenic
1080227090 11:29973853-29973875 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1080417728 11:32084337-32084359 ACTCACATAGGGCAGAGAAAAGG + Intronic
1080887456 11:36379698-36379720 TTTCACATGGAGCCAAGGAGGGG + Intronic
1081356538 11:42121155-42121177 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1082197993 11:49326394-49326416 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1084353738 11:68623258-68623280 TTTCTCACGGAGCAAAGAACAGG - Intergenic
1084355266 11:68634229-68634251 TTTCTCATGGAGCAAAGAACAGG - Intergenic
1085686791 11:78630907-78630929 TTCCACAGGGGACAAAGAAAGGG - Intergenic
1085911172 11:80828686-80828708 ATTCACATTGGGGAAAGACATGG + Intergenic
1085934037 11:81122573-81122595 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1086125540 11:83345106-83345128 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1086657820 11:89381730-89381752 TTTCTCATGGAGCAAAGAGCAGG - Intronic
1086889298 11:92238015-92238037 TTTCACAGGTGACAAAGATAGGG + Intergenic
1087098812 11:94346182-94346204 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1087127513 11:94642068-94642090 TTTCCCATGGAGCAAAGAACAGG - Intergenic
1087314329 11:96588144-96588166 TTTCTCATGGAGCAAAGAACAGG - Intergenic
1088219981 11:107559477-107559499 CTTCAGAGGGGTCAAAGAAATGG + Intronic
1088907676 11:114166992-114167014 TTTCACTTTGGGTAAAGGAAGGG + Intronic
1089230835 11:116974407-116974429 TTTCAAAAGGGGGAAAAAAAGGG - Intronic
1089472377 11:118731360-118731382 TTTCTCATGGAGCAAAGAACAGG + Intergenic
1089880948 11:121772911-121772933 TTTTTCAAGGGGCAAAGACAGGG + Intergenic
1090546779 11:127774420-127774442 TTTCTCACGGAGCAAAGCAAAGG + Intergenic
1091886228 12:4019050-4019072 TTTCTCACGGAGCAAAGAACAGG - Intergenic
1092627031 12:10338112-10338134 TTTCTCACGGAGCAAAGAACAGG + Intergenic
1092724024 12:11467490-11467512 TTTCTCATGGAGCAAAGAACAGG + Intronic
1092739579 12:11614758-11614780 TTTCTCATGGAGCAAAGAACAGG + Intergenic
1093358289 12:18196217-18196239 TTTCTCATGGAGCAAAGAGCAGG - Intronic
1093578439 12:20763417-20763439 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1094329424 12:29275011-29275033 TTTCTCATGGAGCAAAGAGCAGG - Intronic
1094723658 12:33090341-33090363 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1095579767 12:43784062-43784084 TTTCAGAGGGGGGAAAAAAAAGG + Intronic
1096563717 12:52457763-52457785 TTGTATATGGGGTAAAGAAAGGG + Intergenic
1096706886 12:53427770-53427792 ATCCACATGGGGCTCAGAAAAGG + Intronic
1097079093 12:56416547-56416569 GTTGGCATGGGGCATAGAAAAGG - Exonic
1097305912 12:58068683-58068705 GTTGACTTGGGGCATAGAAAGGG - Intergenic
1097462562 12:59880417-59880439 TTTGACATGTAGAAAAGAAAAGG - Intergenic
1097592132 12:61587539-61587561 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1097712758 12:62934176-62934198 TGTCACTTGGGGAAAAAAAACGG - Intronic
1097901476 12:64877784-64877806 TTTGAGAAGGGGCAAAGAAAAGG - Intronic
1098628757 12:72703731-72703753 GTTCTCATGGAGCAAAGAACAGG - Intergenic
1099188418 12:79540357-79540379 TTTCTCAAGGAGCAAAGAACAGG - Intergenic
1099762282 12:86939191-86939213 TTTCTCACGGAGCAAAGAACAGG - Intergenic
1099836347 12:87912407-87912429 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1100560989 12:95749341-95749363 TTTCTCACGGAGCAAAGAACAGG - Intronic
1101516874 12:105444452-105444474 TTTGACATAAGGCAAAGGAAAGG - Intergenic
1102599934 12:114022026-114022048 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1102638763 12:114347699-114347721 TTTCCCATGGGCCTAAGAGAGGG - Intergenic
1102757906 12:115358278-115358300 TTTCACAGGGAACAAAGAATTGG - Intergenic
1102766854 12:115440802-115440824 GTTCACATCAGCCAAAGAAAAGG + Intergenic
1102934655 12:116886181-116886203 TTTCTCATGAAGTAAAGAAATGG + Intergenic
1104121772 12:125806579-125806601 TTACACATGGGGCTAAGGTATGG + Intergenic
1104300236 12:127558363-127558385 TTTCTCATGGGAAAAATAAAGGG - Intergenic
1104378041 12:128282426-128282448 TTTCACATGGTGGCAGGAAAAGG + Intronic
1106011004 13:25822801-25822823 TTTCACATAGAGCAAAATAATGG + Intronic
1106194570 13:27482167-27482189 TTTCACAAGGGCCAAAGAATTGG - Intergenic
1106943185 13:34799415-34799437 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1107027862 13:35822099-35822121 TTTTACTTGGGGAAAAAAAAAGG - Intronic
1107272321 13:38634625-38634647 TCTCATATGGGGCAAAGCCAAGG - Intergenic
1107423184 13:40268736-40268758 TTTCACATCAGGGAAAGAAGGGG + Intergenic
1107683434 13:42872625-42872647 TTTCTCATGGAGCAAAGAACAGG + Intergenic
1108782844 13:53857753-53857775 TTTTATTTGGGGCAAAGACAAGG - Intergenic
1108913726 13:55583557-55583579 TTTCTCATGGAGCAAACAACAGG + Intergenic
1108919848 13:55660276-55660298 TTTCTCACGGAGCAAAGAACAGG + Intergenic
1108947142 13:56040760-56040782 TTTCTCACGGAGCAAAGAACAGG - Intergenic
1108953249 13:56117728-56117750 TTTCTCACGGAGCAAAGAACAGG + Intergenic
1109717091 13:66231809-66231831 TTTCTCATGGAGCAAAGAACAGG + Intergenic
1109926509 13:69147913-69147935 TTTCACGTAGGGCAAATACATGG + Intergenic
1110316698 13:74116263-74116285 TTTCCCTAGGAGCAAAGAAATGG - Intronic
1111285994 13:86092415-86092437 TATCACTTGAGCCAAAGAAAGGG - Intergenic
1111301707 13:86358675-86358697 TTTCTCACGGAGCAAAGAACAGG - Intergenic
1111362403 13:87191619-87191641 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1111459181 13:88518212-88518234 TTTCTCATGGAGCAAAGAACAGG + Intergenic
1111597534 13:90430257-90430279 TAACACATGGGGCAAAGAAAAGG - Intergenic
1111630182 13:90840050-90840072 TTTCTCATGGAGCAAAGAACAGG - Intergenic
1111631981 13:90853750-90853772 TTTCTCACGGAGCAAAGAACAGG + Intergenic
1112297651 13:98202368-98202390 TTCAACATGGGGCACAGAAGTGG + Intronic
1113030279 13:105985633-105985655 TTTCACTTGGGCTAAAGTAAAGG - Intergenic
1113323972 13:109265578-109265600 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1113445618 13:110364150-110364172 TTTTACATGCTGCACAGAAAGGG + Intronic
1113820342 13:113208954-113208976 TTTCACAAGGGGCAGACGAAGGG - Intronic
1115240919 14:31250591-31250613 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1115446556 14:33497355-33497377 TTTCATATGGAGCCAAAAAAGGG + Intronic
1115790682 14:36874263-36874285 TTTCATATAGTGCAAATAAATGG + Intronic
1115904485 14:38191142-38191164 TTTCTCACGGAGCAAAGAACAGG - Intergenic
1116020211 14:39451581-39451603 TTTCACTTGGGGGAAAGAATGGG + Intergenic
1116179372 14:41516379-41516401 TTTCTCATGGAGCAAAGAACAGG - Intergenic
1116440900 14:44951592-44951614 TTTAAAATGGGCCAAAGAAAAGG + Intronic
1116476419 14:45346010-45346032 TTTCACAGGAGGAAAATAAAAGG - Intergenic
1116535072 14:46017616-46017638 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1116775334 14:49173826-49173848 TTCCACTTGGGGGAAAGAGAAGG + Intergenic
1116952616 14:50893669-50893691 TTTCTCATGGAGCAAAGAGCAGG - Intronic
1118400725 14:65376893-65376915 TTTCACGTGAGGGATAGAAAAGG + Intergenic
1118587185 14:67365594-67365616 ATTTACATGGGGCCCAGAAAAGG - Intronic
1119228407 14:72961495-72961517 TTCCACATGGGTCAGAGACAAGG + Intergenic
1119554549 14:75543047-75543069 TCTCAGAGGGGGCGAAGAAAAGG + Intronic
1120115655 14:80614375-80614397 TGTCACATGAGCCAAAGGAAGGG - Intronic
1120213366 14:81656342-81656364 TTTTATCTGGGGAAAAGAAATGG - Intergenic
1120310631 14:82822990-82823012 GTACACATGTGGCAGAGAAAAGG + Intergenic
1121188592 14:92001166-92001188 TTTAAAATGGAGAAAAGAAACGG - Intronic
1121703359 14:95973489-95973511 TTTCTCACGGAGCAAAGAACAGG - Intergenic
1122040713 14:98985743-98985765 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1122381590 14:101310768-101310790 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1123395132 15:19926356-19926378 GTTCACAGGGGGAAAAAAAAAGG + Intergenic
1126526765 15:49664875-49664897 TTTGATATGGGGGAAAGGAAAGG + Intergenic
1126530429 15:49704264-49704286 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1126912665 15:53431951-53431973 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1127541376 15:59942005-59942027 TTTCACATGAGAGAAAAAAATGG - Intergenic
1128849277 15:70935547-70935569 TTTCAGATGGAGGGAAGAAAAGG + Intronic
1129605417 15:77022709-77022731 TTTCATCTGGGGCCAAGAAAGGG + Intronic
1130854786 15:87831614-87831636 TTTCTCATGGAGCAAAGAACAGG - Intergenic
1130947770 15:88561731-88561753 TTTCTCATGGAGCAAAGAACAGG + Intergenic
1131662092 15:94528474-94528496 TTTTCCATGGGTAAAAGAAAAGG - Intergenic
1131882821 15:96877136-96877158 TTTCTCACGGAGCAAAGAACAGG + Intergenic
1131952835 15:97700090-97700112 TATCACATGGGGCAAAGTATGGG - Intergenic
1133767000 16:8844948-8844970 TTTCTCATGGAGCAAAGAGCAGG + Intronic
1134318744 16:13143458-13143480 TTTCACATGAGGCAGAGGAAAGG + Intronic
1134356404 16:13486220-13486242 TTTCACATGGACCAGCGAAATGG + Intergenic
1134504084 16:14791156-14791178 TGTGACCTGGGGCAAGGAAATGG + Intronic
1134576488 16:15337752-15337774 TGTGACCTGGGGCAAGGAAATGG - Intergenic
1134725955 16:16418747-16418769 TGTGACCTGGGGCAAGGAAATGG + Intergenic
1134941479 16:18293112-18293134 TGTGACCTGGGGCAAGGAAATGG - Intergenic
1135336259 16:21603956-21603978 TTTCATTTGGGGGAAAAAAAAGG - Intronic
1135412119 16:22243147-22243169 TTTCACATAGGGCAGTAAAATGG + Intronic
1137794836 16:51207264-51207286 AGTCACATGGGTAAAAGAAAAGG - Intergenic
1139943302 16:70621530-70621552 TTTCTCATGGAGCAAAGAACAGG + Intronic
1140240976 16:73200032-73200054 TTCCACATGGAAAAAAGAAATGG + Intergenic
1141239002 16:82247316-82247338 TTTCAAATAAGACAAAGAAATGG + Intergenic
1143435252 17:6919770-6919792 TTTCACAAAGGCCAAAGACAGGG - Intronic
1144104333 17:11972246-11972268 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1144303344 17:13944302-13944324 TTTAGCATGGGAAAAAGAAAGGG + Intergenic
1144392926 17:14812812-14812834 CTTTCCATGGGGCAAAGGAAGGG - Intergenic
1146597578 17:34183680-34183702 TTTCTCACGGAGCAAAGAACAGG - Intergenic
1147013751 17:37473547-37473569 TTTCAAGTGGGGCAGAGAAAGGG - Intronic
1147021767 17:37540280-37540302 TTTCACATGGGGAAAATGAGGGG - Intronic
1147118566 17:38321295-38321317 TTTGACAGGGGGCAGAGAGACGG - Intronic
1149542920 17:57481709-57481731 TTGCAGAAGGGGCAAGGAAAAGG + Intronic
1151409131 17:73909570-73909592 TTTCTCAGGGGCCAAAAAAAGGG + Intergenic
1153349728 18:4065825-4065847 ATTCACATGGAACAAAAAAAGGG + Intronic
1155892972 18:31289446-31289468 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1156252167 18:35361303-35361325 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1156302004 18:35844561-35844583 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1156915595 18:42462285-42462307 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1157116047 18:44863813-44863835 TTTCTTATGGGCCAAAGCAAAGG - Intronic
1157889466 18:51401610-51401632 ATTCACATGGGAAAGAGAAATGG - Intergenic
1158299527 18:56035687-56035709 TCTCACATGGGGGAAGGGAAAGG + Intergenic
1159068678 18:63597550-63597572 TTACGCATGGCACAAAGAAAAGG - Exonic
1159834739 18:73325104-73325126 TTTCTCACAGGGCAAAGAAAAGG - Intergenic
1160240099 18:77117499-77117521 TTTCACAAGGGGTAAAGAACAGG + Intronic
1161002616 19:1918372-1918394 TTTCACACTGGGCAGAGAAAGGG - Intronic
1163892685 19:20030843-20030865 TTTCACTTGGGTGAAAAAAAAGG - Intronic
1164459557 19:28435271-28435293 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1164864955 19:31597075-31597097 TTACAGATGGGGCACAGAGACGG - Intergenic
1165248965 19:34514553-34514575 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1166499270 19:43328872-43328894 TTTCTCACGGAGCAAAGAACAGG + Intergenic
1167874519 19:52400343-52400365 TCTTACATGGAGCACAGAAAAGG - Intronic
1168212408 19:54900104-54900126 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
925103116 2:1266340-1266362 TTGCAGATGGGGGAAAGAAGTGG + Intronic
925544215 2:5001275-5001297 TTTCTCACGGAGCAAAGAACAGG - Intergenic
925829241 2:7878360-7878382 TTTCTCATGGAGCAAAGAACAGG + Intergenic
926464371 2:13169183-13169205 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
926815856 2:16797191-16797213 TTTCTCATGGAGCAAAGAACAGG + Intergenic
926896726 2:17698961-17698983 TTTAAAATGGGGAAAAGAAAAGG - Intronic
927141311 2:20132812-20132834 TTTCAGATGGGGCAGAAAACAGG + Intergenic
928928270 2:36599585-36599607 TTTCTCATGGAGCAAAGAGCAGG - Intronic
929076989 2:38086034-38086056 TTTCTCATGGAGCAAAGAACAGG + Intronic
929246140 2:39705827-39705849 GTACACATGGGGCCAAGACAAGG - Intronic
929513492 2:42584875-42584897 TTTCTCTTGGGGGAAAAAAATGG + Intronic
929704937 2:44200497-44200519 TTTAACATGGTGCTAAAAAATGG - Intronic
929841096 2:45464112-45464134 TTGCAGAGGGGGTAAAGAAATGG + Intronic
929916720 2:46142648-46142670 TTTCCCCTGGGGAGAAGAAAGGG + Intronic
930501902 2:52232142-52232164 TTGTACATGGTGTAAAGAAAGGG - Intergenic
930954705 2:57192790-57192812 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
930954819 2:57193553-57193575 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
931026690 2:58118619-58118641 TTTCTCATGGAGCAAAGAGCAGG + Intronic
931042395 2:58314624-58314646 TTTCTCATGGAGCAAAGAACAGG - Intergenic
931236584 2:60417892-60417914 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
931947949 2:67331973-67331995 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
932119292 2:69083378-69083400 ATTCAGATGGGGCGAAGGAAGGG - Intronic
932295521 2:70620956-70620978 TTTCTCATGGAACAAAGAACAGG - Intronic
932359159 2:71090466-71090488 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
932854498 2:75218999-75219021 TTTCTCATGGAGCAAAGAGTAGG + Intergenic
932974264 2:76579173-76579195 TTTCTCACGGAGCAAAGAACAGG + Intergenic
933388277 2:81638844-81638866 TTTCATATGGAACCAAGAAAGGG + Intergenic
933406790 2:81870642-81870664 TATCTCATGGGTCAAAGAAGAGG - Intergenic
934750149 2:96788857-96788879 TTTCTCATGGGGAAAAGCCAGGG - Intronic
934801749 2:97169931-97169953 TTTCATATGGAACAAAAAAAGGG + Intronic
935867003 2:107399393-107399415 TATCACATGAGGCACAGAAAGGG - Intergenic
936883055 2:117279262-117279284 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
937065821 2:119016845-119016867 TTTTAAATGGGGCAAAGCAAGGG - Intergenic
938595104 2:132780932-132780954 TTGCAACTGGGGGAAAGAAAAGG - Intronic
939083430 2:137688173-137688195 TTTCTCACGGAGCAAAGAACAGG + Intergenic
939560070 2:143721394-143721416 TTTTCCATGGGGAGAAGAAAAGG + Intronic
940182713 2:150953797-150953819 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
940409378 2:153342937-153342959 TTACACATGTGTCAAGGAAAAGG + Intergenic
940529888 2:154867783-154867805 TTTTTCATGGAGCAAAGAACAGG - Intergenic
940767961 2:157810307-157810329 TTTAACATGAGGCAAGGAAATGG + Intronic
941340107 2:164296317-164296339 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
941434911 2:165457859-165457881 TTTCAAAAGTGGCGAAGAAAGGG + Intergenic
941547155 2:166865700-166865722 TTGAAAATGGGGCAAAGCAAAGG - Intergenic
941616558 2:167727017-167727039 TGTTACCTGGGACAAAGAAAGGG - Intergenic
942842487 2:180379416-180379438 TCTCACATGGTAGAAAGAAAAGG - Intergenic
942991722 2:182209712-182209734 TTTCACATGGTGGCAAGAGAGGG - Intronic
943421881 2:187675738-187675760 TTTCTCATGGAGCAAAGAACAGG + Intergenic
943524225 2:188996550-188996572 TTCCATATGGAGTAAAGAAATGG + Intronic
943850187 2:192710273-192710295 TTTCTCATGGGGGGAAGAGAAGG - Intergenic
944250796 2:197578833-197578855 TTTCTCATGGAGCAAAGAGCAGG - Intronic
944876430 2:203967197-203967219 TTTCTCATGGAGCAAAGAACAGG + Intergenic
944964562 2:204915217-204915239 TTTAACATGGAGGAAAAAAATGG - Intronic
945153408 2:206812096-206812118 TTTCTCATGGAGCAAAGAACAGG + Intergenic
945212983 2:207402787-207402809 TCTCCTTTGGGGCAAAGAAAGGG - Intergenic
945375804 2:209078528-209078550 TTTCTCACGGAGCAAAGAGAAGG - Intergenic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
945938009 2:215922814-215922836 TTTGTCATGGAGCAAAGAACAGG - Intergenic
946215358 2:218179377-218179399 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
946383299 2:219364449-219364471 TTTCACATGGGGAAAGGATCAGG - Intergenic
946863901 2:224025466-224025488 TTTCTCATTGGGAAAAGAAGAGG - Intronic
946886205 2:224225787-224225809 TTTCTCACGGAGCAAAGAACAGG - Intergenic
948390344 2:237607254-237607276 TTTTTCATGGAGCAAAGAACAGG - Intergenic
948413790 2:237785484-237785506 TTTCACATGGGAGAATGCAAAGG + Intronic
948683200 2:239651608-239651630 TTACAAAATGGGCAAAGAAAAGG + Intergenic
1169160067 20:3370054-3370076 TTTGAAATGAGGCAATGAAAAGG + Intronic
1170325780 20:15153071-15153093 TTTCTCATGGAGCAAAGAGCAGG + Intronic
1172436981 20:34936130-34936152 TATCAAATAGGTCAAAGAAAAGG - Intronic
1172695327 20:36818450-36818472 TTACACATGAGGCTTAGAAATGG + Intronic
1172923356 20:38506763-38506785 TTTGATAGGGGGCAAAGAGAGGG + Intronic
1173009690 20:39170542-39170564 TAACACAGGGAGCAAAGAAAGGG + Intergenic
1173101586 20:40093600-40093622 TTTCTCATGGAGCAAAGAACAGG - Intergenic
1174340307 20:49891193-49891215 TTTCACATGCAGAAGAGAAAAGG + Exonic
1177031414 21:15984822-15984844 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1177102424 21:16914587-16914609 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1177409270 21:20708668-20708690 TTGTACATGGGGAAAACAAAGGG - Intergenic
1177544689 21:22541282-22541304 GTGCACATGGGGAAAAAAAAAGG + Intergenic
1177683127 21:24401363-24401385 TTTCAGAAGTGGCAAACAAAAGG + Intergenic
1178000965 21:28161898-28161920 TTTCTCATGGAGCAAAGAGTAGG - Intergenic
1178777132 21:35562602-35562624 ATTCACATGGTGGAAGGAAAGGG - Intronic
1178934958 21:36853306-36853328 TCTCCCATGTGACAAAGAAAGGG + Intronic
1179015533 21:37592016-37592038 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1179387229 21:40955277-40955299 TTTCTCAGGGAGCAAAGAACAGG - Intergenic
1179523815 21:41962569-41962591 CTTCACATGGTGCGAAGAGAGGG + Intergenic
1179650608 21:42806053-42806075 TTTCTCATGGTGCAAAGAGCAGG + Intergenic
1179682361 21:43032405-43032427 TTTCTAGTGGGGGAAAGAAACGG - Exonic
1181183511 22:21084123-21084145 TTTTACATTTGGCAAAGAATAGG + Intergenic
1182731983 22:32503244-32503266 TTTCTCACGGAGCAAAGAACAGG - Intergenic
1183496402 22:38147160-38147182 TTTCAAATGGGGCTCAGAGAGGG - Intronic
1184565372 22:45288747-45288769 TGTTACATGGAGGAAAGAAATGG + Intronic
1184868418 22:47217664-47217686 ACTAACATGGGGAAAAGAAAAGG - Intergenic
1184875844 22:47274997-47275019 TACCACATGGGGCAAAGAAAGGG - Intergenic
949766608 3:7533982-7534004 TTTAAAATGTGGCATAGAAAGGG + Intronic
949827140 3:8177500-8177522 TTTTTCATGGAGCAAAGAACAGG - Intergenic
950354494 3:12394819-12394841 CTTCACATTGGTCAAAGCAATGG - Intronic
950874281 3:16256023-16256045 TTGCACATGGACCAAGGAAAGGG - Intergenic
951299103 3:20972739-20972761 TTTTTCATGGAGCAAAGAACAGG + Intergenic
951662959 3:25090859-25090881 TTTCATGTGGGGGAAAGAGATGG + Intergenic
952442441 3:33345787-33345809 TAATACATGGGTCAAAGAAAAGG + Intronic
952688315 3:36175186-36175208 TTTCACTTGACGAAAAGAAAAGG - Intergenic
953346950 3:42184151-42184173 TTTCACATGAGGCAAAAATAAGG + Intronic
953826005 3:46251527-46251549 TTTCTCACGGAGCAAAGAACAGG + Intronic
954734537 3:52695058-52695080 TTTCACATGGCGCAACGATGTGG - Intronic
955067934 3:55548477-55548499 TGGCACATGGGGCAATGAATGGG - Intronic
955447113 3:59024343-59024365 TTACAAATGGGGCTTAGAAATGG + Intronic
956176504 3:66478123-66478145 TTTCAAAGGCGGCAAATAAACGG - Intronic
956233727 3:67043672-67043694 TTTCTCATGGAGCAAAGACCAGG + Intergenic
956549225 3:70439924-70439946 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
957294907 3:78324163-78324185 TTTCTCATGGAGCATAGAACAGG - Intergenic
957317614 3:78588387-78588409 TTTCTCACGGAGCAAAGAACAGG + Intergenic
957384059 3:79472293-79472315 ATTCAGAGGGGGCCAAGAAATGG + Intronic
957514714 3:81235154-81235176 ATTCACATGTGGCAGAGAAGAGG - Intergenic
959486048 3:106927902-106927924 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
959613422 3:108320287-108320309 TTTCACATGCAGAAAATAAAAGG - Intronic
959654819 3:108791396-108791418 TTTCTGATGGGTCCAAGAAAAGG - Intergenic
960203829 3:114870900-114870922 TTTCACTTGGGTAAAAGGAAGGG - Intronic
960283158 3:115798636-115798658 TTTCTCATGGAGCAAAGAACAGG + Intergenic
961880725 3:130059618-130059640 TTTTTCATGGAGCAAAGAACAGG - Intergenic
961885082 3:130091732-130091754 TGTCTCATGGGGCTAAGGAAGGG + Intronic
962147858 3:132859766-132859788 TTTCTCATGGAGAAAAAAAATGG - Intergenic
962648882 3:137467893-137467915 TATCAGATGGGGCTCAGAAAAGG - Intergenic
963112074 3:141696224-141696246 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
963424938 3:145113529-145113551 TTTCTCACGGAGCAAAGAACAGG - Intergenic
963456972 3:145556432-145556454 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
963468335 3:145710905-145710927 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
963521334 3:146362554-146362576 TTTCTCATGGAGCAAAAAACAGG - Intergenic
963663011 3:148152016-148152038 TTTCTCATGGAGCAAACAACAGG - Intergenic
963903917 3:150758269-150758291 TTTCAGAGAGGACAAAGAAAAGG + Intronic
964067521 3:152597483-152597505 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
964906856 3:161727290-161727312 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
965105508 3:164347360-164347382 TTTCTCATGGAGCAAAGAAGAGG + Intergenic
965287006 3:166829218-166829240 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
965626641 3:170688726-170688748 TTTCTCATGGAGCAAAGAGCAGG + Intronic
965664720 3:171080975-171080997 TTTCTCATGAGGCACAGATAGGG - Intronic
965713087 3:171576845-171576867 TTTCTCACGGAGCAAAGAACAGG - Intergenic
965925799 3:173978114-173978136 TTTCACAAGGAACAAATAAATGG + Intronic
966066504 3:175827993-175828015 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
966397414 3:179517539-179517561 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
966470094 3:180279598-180279620 TTTCACATGGGTAAAATGAAAGG + Intergenic
967151831 3:186658229-186658251 TTTCTCACGGAGCAAAGAACAGG - Intergenic
967212462 3:187180732-187180754 TTTCTCATGGAGCAAAGAACAGG + Intronic
967244462 3:187471513-187471535 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
967495939 3:190145053-190145075 TTTCTCAAGGAGCAAAGAACAGG - Intergenic
967561109 3:190920669-190920691 TTTCTCATGGAGCAAAGAACAGG - Intergenic
967624976 3:191671847-191671869 TTTCTCATGGAGCAAAGAACAGG + Intergenic
967740191 3:192996115-192996137 TTTCTCACGGAGCAAAGAACAGG - Intergenic
968200866 3:196753981-196754003 GTTCACATAGGGGACAGAAATGG - Intronic
969059844 4:4425889-4425911 TTTGATATGGGCCAAAGAAAAGG + Intronic
970041821 4:11806802-11806824 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
970648700 4:18153667-18153689 TTTCAGATGGCACAAATAAATGG + Intergenic
970723617 4:19016819-19016841 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
971123506 4:23727339-23727361 TTTCTCACGGAGCAAAGAACAGG + Intergenic
971552526 4:27975360-27975382 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
972079945 4:35138191-35138213 TTTCACATGTGGCAATTAATGGG - Intergenic
973086435 4:46067911-46067933 TTTCACAAGGTTCAAAGAATAGG - Intronic
974530975 4:63107548-63107570 TTTAACTTGGGAAAAAGAAAAGG + Intergenic
974787825 4:66643626-66643648 TTTAATATGTGGCAAACAAAAGG + Intergenic
974817993 4:67031025-67031047 TATTTTATGGGGCAAAGAAATGG + Intergenic
975271122 4:72434656-72434678 TTACATATGTGGCAAAGGAAGGG + Intronic
975865409 4:78719191-78719213 TTTCTCATGGAGCAAAGAACAGG + Intergenic
975891828 4:79038592-79038614 TTTAAAATGGGGAAAAGAATAGG + Intergenic
975934179 4:79559179-79559201 TTTCTCACGGAGCAAAGAACAGG + Intergenic
976497384 4:85746150-85746172 TTTCCCAAGTGGGAAAGAAAGGG + Intronic
976558327 4:86475286-86475308 TTTCTCATGGAGCAAAGAGCAGG - Intronic
977009932 4:91624148-91624170 TTTCTCATGGAGCACAGAACAGG - Intergenic
977013252 4:91660037-91660059 TTTCTCATGGAGCACAGAACAGG + Intergenic
977037657 4:91975737-91975759 TTTCACTTGGGGAAAGGAGAGGG - Intergenic
977075481 4:92444123-92444145 TTTCTCACGGAGCAAAGAACAGG + Intronic
977670592 4:99691008-99691030 TTTCAGAAGGAGCAAAGAAAGGG - Intergenic
978029168 4:103917160-103917182 ATTCACATGGGGAATAGAGAAGG - Intergenic
978052431 4:104218432-104218454 TTTCACATGTAGCAATCAAAAGG + Intergenic
979146327 4:117252567-117252589 TTTTTCATGGAGCAAAGAACAGG - Intergenic
979379585 4:119994174-119994196 TTTCTCACGGAGCAAAGAACAGG - Intergenic
979641074 4:123012870-123012892 TTTCTCATGGAGCAAAGAGCAGG + Intronic
979850617 4:125566927-125566949 TTTCTCACGGAGCAAAGAACAGG + Intergenic
979895403 4:126150035-126150057 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
980194233 4:129567031-129567053 TTTTTCATGGGGATAAGAAAGGG + Intergenic
980284677 4:130767869-130767891 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
980323381 4:131308049-131308071 TTTCACATGGGGGCAGGAGAGGG + Intergenic
980341101 4:131548260-131548282 TTTCACATCTGTAAAAGAAAGGG - Intergenic
980388622 4:132118649-132118671 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
980491578 4:133534126-133534148 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
980527594 4:134012679-134012701 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
981488946 4:145319184-145319206 TATCACAGAGGGCAAAGAAGAGG - Intergenic
981539397 4:145833068-145833090 TTTCTCACGGAGCAAAGAACAGG - Intronic
981638650 4:146910830-146910852 TTTGAAATGGGGAAGAGAAAAGG + Intronic
982084240 4:151817750-151817772 TTTCTCATGGAGCAAAGAACAGG + Intergenic
982180792 4:152746628-152746650 TTTCTCATGGAGCAAAGAGCAGG + Intronic
982414492 4:155113706-155113728 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
982535125 4:156600703-156600725 TTTCTTATGGAGCAAAGAACAGG - Intergenic
983023579 4:162709642-162709664 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
983055202 4:163093661-163093683 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
983345307 4:166521157-166521179 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
983360088 4:166716634-166716656 TTTCTCACGGAGCAAAGAACAGG - Intergenic
983368513 4:166827564-166827586 TTTCCCATGGGAAAAATAAATGG + Intronic
983707420 4:170678103-170678125 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
983755431 4:171329021-171329043 TTCCACTTGGGGAAAGGAAAGGG + Intergenic
984099325 4:175466602-175466624 TTTCTCACGGAGCAAAGAACAGG + Intergenic
985079244 4:186247138-186247160 TTTCTCATGGAGCAAAGAGCAGG + Intronic
985390204 4:189484875-189484897 TTTCTCACGGAGCAAAGAACAGG + Intergenic
985435445 4:189926351-189926373 TTTCTCACGGAGCAAAGAACAGG - Intergenic
985581973 5:702958-702980 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
985958127 5:3279571-3279593 TTTCTCATGGGGCTTTGAAATGG - Intergenic
986193239 5:5516031-5516053 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
986388585 5:7264087-7264109 TTTCTCACGGAGCAAAGAACAGG - Intergenic
986600983 5:9473021-9473043 TAAAATATGGGGCAAAGAAATGG - Intronic
986905492 5:12490379-12490401 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
989103666 5:37841217-37841239 ATTCACATGGGGCATGGAATTGG + Intergenic
989471532 5:41825048-41825070 TTTCACAGAAGGCACAGAAAAGG + Intronic
989689130 5:44119663-44119685 TTTCTCATGGAGCAAAGAGCGGG + Intergenic
991021539 5:61984618-61984640 TTTAACATGAGCCAAAGAAATGG + Intergenic
991356843 5:65777484-65777506 ATTAAAATGGGGAAAAGAAATGG + Exonic
991482308 5:67094559-67094581 TTTGTCAAGGGGCAAAAAAAAGG - Intronic
992283478 5:75206931-75206953 TTTCACAGCAGGCAAAGAAAAGG + Intronic
992394353 5:76357764-76357786 TTTCTCACGGAGCAAAGAACAGG - Intergenic
992960531 5:81953720-81953742 TTTCTCATGGATCAAAGAACAGG - Intergenic
993192365 5:84698727-84698749 TTTCTCATGGAGCAAAGAACAGG - Intergenic
993551904 5:89283637-89283659 TTTCCCATGGTGCTTAGAAAAGG - Intergenic
993836361 5:92824232-92824254 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
994532894 5:100989714-100989736 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
994775408 5:104032177-104032199 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
994779349 5:104069950-104069972 TTTCTCACGGAGCAAAGAACAGG + Intergenic
994903960 5:105812322-105812344 TTTCAGATGGAGCCAGGAAAGGG - Intergenic
995023524 5:107393490-107393512 ATTGACATGGGACACAGAAAAGG - Intronic
995502664 5:112824824-112824846 TTACACTTGGGTAAAAGAAAAGG - Intronic
996203569 5:120702880-120702902 TTTCTCAGGGAGCAAAGAACAGG + Intergenic
996745826 5:126845174-126845196 TTTCTCACGGAGCAAAGAACAGG + Intergenic
997201930 5:132015607-132015629 CTACACATGGGGAAAAGACAGGG - Intergenic
997746127 5:136301892-136301914 TTTCTCATGGAGCAAAGAGCAGG - Intronic
997772967 5:136570716-136570738 TTTCTCATGGAGCAAAGAACAGG + Intergenic
997836731 5:137200324-137200346 TTTCAGATGGGGCCAGGGAAAGG - Intronic
997973604 5:138424948-138424970 TTTAAGATGGGGCAGAGAAGGGG + Intronic
999472923 5:151871904-151871926 GTTCACATGGAAGAAAGAAAGGG + Intronic
999619155 5:153454886-153454908 TTTCTCACGGAGCAAAGAACAGG + Intergenic
999623324 5:153493828-153493850 TTTGGCATGGGGAGAAGAAAAGG + Intronic
1000606694 5:163334790-163334812 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1000885587 5:166744170-166744192 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1001220265 5:169894545-169894567 TTTCACAAGGGGAAGAGAAGGGG + Intronic
1003204505 6:3994727-3994749 TATCACATGGGGCTAGGGAAGGG + Intergenic
1003430489 6:6033106-6033128 TTTCTCACGGAGCAAAGAACAGG + Intergenic
1003441779 6:6149562-6149584 CCTCACATGGGGCAGAGAGAGGG - Intronic
1004105905 6:12667639-12667661 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1004283853 6:14302297-14302319 TTTCTCACGGAGCAAAGAACAGG + Intergenic
1004418781 6:15449102-15449124 CTTCACATGGGACAATGAAGTGG - Intronic
1004574934 6:16886443-16886465 TTTCTCATGGAGCAAAGAACAGG - Intergenic
1005014964 6:21366736-21366758 CTTCTCATGGAGCAAAGAACAGG + Intergenic
1005377275 6:25196199-25196221 AGCCACATGGGGCAAAGCAAGGG + Intergenic
1005724749 6:28637710-28637732 TTCCACATGGGGAGAGGAAAAGG - Intergenic
1006736297 6:36275747-36275769 TTTCACATGGGGCAAAGAAAGGG - Intronic
1007125864 6:39425090-39425112 TTACCCATGGGCCAAAGAGAGGG + Intronic
1007809731 6:44477209-44477231 TTCCACAGGGGGCCATGAAATGG + Intergenic
1008519825 6:52352352-52352374 ATTTAAATGGGCCAAAGAAATGG + Intergenic
1008850585 6:56016307-56016329 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1009319751 6:62272994-62273016 TTGCACATGAGGAAAAAAAAGGG + Intronic
1009343323 6:62586439-62586461 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1009359092 6:62792084-62792106 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1009378895 6:63005940-63005962 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1009406282 6:63317333-63317355 TGTGACATGGGGCAAAGTATTGG - Intronic
1009458363 6:63883403-63883425 TTTCACAAGGGTAGAAGAAATGG - Intronic
1009518538 6:64652314-64652336 TCTCTGATGGGGCACAGAAAGGG + Intronic
1009906855 6:69880112-69880134 TCTCAGATGAGGCAAACAAAAGG + Intronic
1010587041 6:77665919-77665941 TTTCTCATGGAGCAAAGAACAGG + Intergenic
1010829917 6:80515312-80515334 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1011008024 6:82670008-82670030 TTTTAAATGTGGCATAGAAAAGG - Intergenic
1012014665 6:93835218-93835240 TTTCTCATGGAGCAAAGAACAGG + Intergenic
1012066817 6:94559080-94559102 TTTCTCATGGAGCAAAGAACAGG + Intergenic
1012315509 6:97780006-97780028 TTTCTCATGGAGCAAAGAACAGG - Intergenic
1013408201 6:109861087-109861109 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1013844025 6:114427766-114427788 TTTCTCACGGAGCAAAGAACAGG + Intergenic
1014555534 6:122840268-122840290 TTTCTCACGGAGCAAAGAACAGG - Intergenic
1014614963 6:123587526-123587548 TTTCTCACGGAGCAAAGAACAGG + Intronic
1014718314 6:124890897-124890919 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1014754366 6:125287340-125287362 TTTCGATTGGGGCAAAGAGAAGG + Intronic
1014794326 6:125707233-125707255 TTTCTCACGGAGCAAAGAACAGG + Intergenic
1015269352 6:131323805-131323827 TTTCTCATGGAGCAAAGAACAGG - Intergenic
1015316872 6:131826861-131826883 TCTCACATAGGGGAAAGATAAGG + Intronic
1015323508 6:131902062-131902084 TTTCTCACGGAGCAAAGAACAGG - Intergenic
1016248530 6:142016176-142016198 TTTCTCATGGAGCAAAGAACAGG - Intergenic
1016807615 6:148227858-148227880 TGTGACATGGTGCAAAGAAGAGG + Intergenic
1017662629 6:156688523-156688545 TTACTCAGGGGGCATAGAAAAGG + Intergenic
1017779650 6:157706006-157706028 TTTCTCATGGAGCAAAGAGCAGG + Intronic
1018084810 6:160291832-160291854 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1018521820 6:164657573-164657595 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1020315747 7:6904259-6904281 TTTTTCATGGAGCAAAGAACAGG - Intergenic
1020533014 7:9358676-9358698 TTTCTCACGGAGCAAAGAACAGG + Intergenic
1020541402 7:9463684-9463706 TTTCTCATGGAGCAAAGAGCGGG + Intergenic
1021060404 7:16103990-16104012 AGAAACATGGGGCAAAGAAAAGG + Intronic
1021172437 7:17414540-17414562 TTTCTCATGGAGCAAAGAGTGGG - Intergenic
1021601837 7:22372183-22372205 ATTTACATGAGGCAAAGAACAGG + Intergenic
1022372598 7:29785448-29785470 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1022572996 7:31471896-31471918 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1022708819 7:32833075-32833097 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1022889355 7:34680898-34680920 TTTTACATGGGGCACAGGAAGGG + Intronic
1024739476 7:52338593-52338615 TTTCTCATGGAGCAAAGAGGAGG + Intergenic
1025061643 7:55813551-55813573 TTCCACTTGTGGGAAAGAAAAGG + Intronic
1025061649 7:55813645-55813667 TTCCACTTGTGGGAAAGAAAAGG + Intronic
1025733357 7:64125940-64125962 TTTTACATGTGGAAAGGAAAGGG - Intronic
1026424592 7:70277533-70277555 TGTCACAATGGGCACAGAAAGGG - Intronic
1027463967 7:78491436-78491458 TTTCACATGGAATAAAGAGAAGG + Intronic
1027851653 7:83460177-83460199 TTTCTCATGGAGCAAAGAACAGG - Intronic
1028689892 7:93640403-93640425 TTTCTCATGGAGCAAAGAGCAGG - Intronic
1029194761 7:98797482-98797504 TTGCAGATGGGGCAGAGCAAGGG + Intergenic
1029499942 7:100922728-100922750 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1029844725 7:103401045-103401067 TTTCACATGGGACCAAAAAAGGG - Intronic
1030090843 7:105857221-105857243 TTTTACATGGGCCACAGTAAAGG - Intronic
1031161518 7:118174369-118174391 TATCACATGGGGTAAAGACTTGG + Intergenic
1031403662 7:121356565-121356587 TTTCAAATGGAGAAATGAAAGGG + Intronic
1031422741 7:121569189-121569211 TTTCTCATGGAGCAAAGAACAGG + Intergenic
1031525255 7:122817235-122817257 TTTCTCATGGAGCAAAGAACAGG - Intronic
1031776030 7:125910471-125910493 TTTCTCATGGAGCAAAGAACAGG - Intergenic
1031777031 7:125918029-125918051 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1032710227 7:134454727-134454749 CTTCACTTTGGGTAAAGAAACGG + Intronic
1032995061 7:137435629-137435651 TCTGATATGGGGCAAAAAAAAGG + Intronic
1033465322 7:141583964-141583986 TTTCTCATGGAGCAAAGAGCAGG + Intronic
1033676256 7:143542428-143542450 TTTCTCACGGAGCAAAGAACAGG + Intergenic
1033695577 7:143787011-143787033 TTTCTCACGGAGCAAAGAACAGG - Intergenic
1033727423 7:144133651-144133673 TATCACAGGGTGCAAATAAAGGG + Intergenic
1034144347 7:148855246-148855268 ACACACATGGGGCAAAGAATTGG + Intronic
1034333851 7:150307760-150307782 TTTCTCATGGAGCAAAGAGCAGG - Intronic
1035131538 7:156659114-156659136 TTTCATATGGGGACAAGGAATGG - Intronic
1036381865 8:8240896-8240918 TGTCTCATGGGGCTAAGGAAGGG - Intergenic
1036474903 8:9084385-9084407 TTCCACTACGGGCAAAGAAAAGG - Intronic
1037634641 8:20690861-20690883 AGTCACATGGGGCAAAATAAAGG + Intergenic
1037937300 8:22923789-22923811 CTTCACATGGGGGAAGGGAAGGG - Intronic
1038947850 8:32381077-32381099 TTTAACTTGGGTGAAAGAAATGG - Intronic
1039791339 8:40878228-40878250 TTTCAGAAGGGGCAAAGTTAGGG + Intronic
1040647786 8:49420216-49420238 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1040720437 8:50314710-50314732 TTCGACATGGGGTAAAGGAAGGG - Intronic
1040860171 8:51990764-51990786 TAACAAATGGGGCACAGAAAGGG + Intergenic
1041652078 8:60311492-60311514 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1041712789 8:60909195-60909217 TTTCTCATGGGGCAGAGAAAAGG - Intergenic
1041881331 8:62753419-62753441 TATCACATGTGGCAAAGAAAGGG + Intronic
1041887464 8:62827270-62827292 TTACACACGAGGCAAAGAACTGG + Intronic
1042707090 8:71675446-71675468 TTTGTCATGGAGCAAAGAACAGG - Intergenic
1043388638 8:79770165-79770187 TGTCACTTTGGGGAAAGAAATGG - Intergenic
1044148784 8:88747343-88747365 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1044734068 8:95259611-95259633 TTTCAAGTGGGGCTTAGAAAAGG + Intronic
1044921662 8:97175510-97175532 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1044924826 8:97201279-97201301 TTTCTCACGGAGCAAAGAACAGG - Intergenic
1045197178 8:99944182-99944204 TTTCTCACGGAGCAAAGAACAGG - Intergenic
1045824717 8:106383459-106383481 TTTCAAATGAGGCAATGACAAGG - Intronic
1046309662 8:112417729-112417751 TTTCTTTTGGGGCTAAGAAAAGG + Intronic
1046341467 8:112863350-112863372 TTTCATATGGGGCAAGGTAAAGG + Intronic
1046386662 8:113514847-113514869 TTTCTCATGGAGCAAAGAACAGG + Intergenic
1046439767 8:114242113-114242135 TTTCTCATGGAGCAAAGAACAGG - Intergenic
1046442895 8:114282205-114282227 TTTCTCAGGGAGCAAAGAACAGG - Intergenic
1047373904 8:124278280-124278302 TTTTGCATGGGGCAATGACATGG - Intergenic
1047699049 8:127432206-127432228 TTTCTCATGGAGCAAAGAACAGG - Intergenic
1048168739 8:132085472-132085494 TTTCTCATGGAGCAAAGAACAGG + Exonic
1048585746 8:135772501-135772523 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1049869114 8:144959508-144959530 TTTCTCATGGAGCAAAGAACAGG + Intergenic
1050473871 9:6020526-6020548 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1050646858 9:7729498-7729520 TTTCACAAGAGACAAAGAATTGG + Intergenic
1050895828 9:10885435-10885457 TTTCTTATGGAGCAAAGAACAGG - Intergenic
1050911467 9:11077313-11077335 TTTCACTTGGGGAAAGGATAGGG - Intergenic
1051159790 9:14194276-14194298 TTTCTCATTGGGGAAAGTAAAGG - Intronic
1051163085 9:14230823-14230845 TTTCACAATGTGCAAAGAATTGG + Intronic
1051900023 9:22027092-22027114 TCTCACAGGGCGGAAAGAAAGGG - Intronic
1051953652 9:22663579-22663601 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1052031898 9:23638299-23638321 TTTCAGATGGAGAAAAAAAAAGG - Intergenic
1052696924 9:31889727-31889749 TTTCAGCTGAGGCAAACAAAGGG - Intergenic
1053174936 9:35915879-35915901 CTCCACATGGGGCAAAGAGCAGG + Intergenic
1053211646 9:36234118-36234140 TTTCATAGGGAGCAAAGAGATGG - Exonic
1053514749 9:38721278-38721300 TTTCACAGGAGAGAAAGAAAAGG - Intergenic
1054713175 9:68531738-68531760 TTTTAGATGGGGCAAAGAAATGG + Intergenic
1054744565 9:68841637-68841659 TTTAACTTGGGACAAAAAAAAGG + Intronic
1055232742 9:74086091-74086113 TTTCTCACGGAGCAAAGAACAGG - Intergenic
1055392054 9:75833484-75833506 TTTCCCATTGGACAAAGCAAAGG - Intergenic
1055496843 9:76863776-76863798 TTTGACATGAGGCAAAGCAGAGG - Intronic
1055754359 9:79542107-79542129 TCTAACATGTGGCAAAGACAAGG - Intergenic
1055809741 9:80137800-80137822 TTTCTCATGGAGCAAAGAACAGG - Intergenic
1055881478 9:81009540-81009562 TTTCTCATGGAGCAAAGAACAGG - Intergenic
1056323520 9:85458832-85458854 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1057234547 9:93348097-93348119 TTTCTCACGGAGCAAAGAACAGG - Intergenic
1057561439 9:96130965-96130987 TATCAAATGGGGGAAAGAGATGG + Intergenic
1057683645 9:97215024-97215046 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1057981704 9:99670290-99670312 TTTCTCACGGAGCAAAGAACAGG - Intergenic
1058009904 9:99965356-99965378 TTACACTTGGGGTATAGAAATGG + Intronic
1058762494 9:108148457-108148479 TTTTAAATGGGAGAAAGAAAAGG + Intergenic
1059546440 9:115179845-115179867 TTTCTCATGGAGCAAAGAGCAGG + Intronic
1059606995 9:115844398-115844420 TTTCTCACGGAGCAAAGAACAGG + Intergenic
1060919972 9:127413719-127413741 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1185990775 X:4892123-4892145 TTTCTCATGGAGCAAAGAACAGG - Intergenic
1186113187 X:6277448-6277470 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1186673400 X:11790538-11790560 TTTTCCATGGGGCATAGAAAAGG - Intergenic
1186930264 X:14381470-14381492 TTTCACATGGCAGAAAAAAATGG - Intergenic
1186937536 X:14466923-14466945 TTCCACATGGGGAAATGAAAGGG + Intergenic
1186954360 X:14665377-14665399 TTTCAGATGAGGAAACGAAAGGG - Intronic
1187086828 X:16049935-16049957 TTTCTCATGGAGCAAAGAACAGG + Intergenic
1187091585 X:16102354-16102376 TTTCTCATGGAGCAAAGACAAGG + Intergenic
1187176172 X:16898074-16898096 TTTCACATACAGCAAAGAGAGGG + Intergenic
1187655187 X:21463850-21463872 TTTCACTTGGGGAGAGGAAATGG - Intronic
1188145001 X:26600702-26600724 TATCACCTGTGGCAAAGATATGG + Intergenic
1188419249 X:29976005-29976027 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1188430792 X:30104071-30104093 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1188564039 X:31505047-31505069 GTTCACATGAGGCAGAGAAAAGG + Intronic
1189135304 X:38543040-38543062 TTTCCCATGGGCCAATGGAAGGG + Intronic
1189562097 X:42201626-42201648 TTTCAAGTGGGGCAAAGACATGG + Intergenic
1191913091 X:66172613-66172635 TTGGGCATGGGGGAAAGAAACGG - Intronic
1191950539 X:66586776-66586798 TTTCATATGGGACCAAAAAAGGG - Intergenic
1192542826 X:71989730-71989752 CTTCCCAGAGGGCAAAGAAAAGG + Intergenic
1192731879 X:73808940-73808962 TTTCTCACGGAGCAAAGAACAGG + Intergenic
1192816245 X:74595708-74595730 TTTCATAAGGGCTAAAGAAATGG + Intronic
1192831643 X:74756491-74756513 TGTCTCATGTGGCAAATAAAAGG - Intronic
1193554957 X:82942059-82942081 TTTCATATGGGGAAAGGAAGTGG + Intergenic
1193885659 X:86982343-86982365 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1194350983 X:92824939-92824961 TTTCTCACGGAGCAAAGAACAGG - Intergenic
1194366808 X:93023427-93023449 TTTTTCATGGAGCAAAGAACAGG - Intergenic
1194823077 X:98529542-98529564 TTTCTCACGGAGCAAAGAACAGG + Intergenic
1195291533 X:103434958-103434980 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1195495549 X:105528295-105528317 TTTCTCATGGGTCAAATAAGGGG - Intronic
1195637641 X:107135544-107135566 TTTCACCAGGGAGAAAGAAAAGG - Intronic
1196072766 X:111544317-111544339 TTTCTCATGGAGCAAAGAACAGG - Intergenic
1196533831 X:116817695-116817717 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1198715246 X:139551645-139551667 TTTAAAAGGGGGTAAAGAAAGGG + Intronic
1199377917 X:147134290-147134312 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1199576162 X:149316091-149316113 TTTCTCATGGAGCAAAGAGCAGG - Intergenic
1200533155 Y:4360702-4360724 TTTCTCATGGAGCAAAGAGCAGG + Intergenic
1200675030 Y:6139683-6139705 TTTTTCATGGAGCAAAGAACAGG - Intergenic
1201332021 Y:12834661-12834683 ATTCAGATGCGCCAAAGAAAAGG + Intronic