ID: 1006739051

View in Genome Browser
Species Human (GRCh38)
Location 6:36294335-36294357
Sequence GTTCTCCAGGGAGAACTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006739051_1006739064 27 Left 1006739051 6:36294335-36294357 CCTTCCAGTTCTCCCTGGAGAAC 0: 1
1: 0
2: 2
3: 21
4: 235
Right 1006739064 6:36294385-36294407 CCCCCGGACCTGGTGGTGAGAGG 0: 1
1: 0
2: 0
3: 22
4: 254
1006739051_1006739061 20 Left 1006739051 6:36294335-36294357 CCTTCCAGTTCTCCCTGGAGAAC 0: 1
1: 0
2: 2
3: 21
4: 235
Right 1006739061 6:36294378-36294400 ATTGTTCCCCCCGGACCTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 66
1006739051_1006739057 11 Left 1006739051 6:36294335-36294357 CCTTCCAGTTCTCCCTGGAGAAC 0: 1
1: 0
2: 2
3: 21
4: 235
Right 1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG 0: 1
1: 0
2: 1
3: 9
4: 66
1006739051_1006739060 17 Left 1006739051 6:36294335-36294357 CCTTCCAGTTCTCCCTGGAGAAC 0: 1
1: 0
2: 2
3: 21
4: 235
Right 1006739060 6:36294375-36294397 CGCATTGTTCCCCCCGGACCTGG 0: 1
1: 0
2: 0
3: 0
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006739051 Original CRISPR GTTCTCCAGGGAGAACTGGA AGG (reversed) Exonic
901647635 1:10725138-10725160 GTTGGCCAGGGAGCCCTGGATGG + Intronic
903754408 1:25650993-25651015 CTCCTCCAAGGAGACCTGGAGGG + Intronic
904401517 1:30259810-30259832 CTTCCCCAGGGCGACCTGGAGGG - Intergenic
905400727 1:37701204-37701226 GTTGTGCAGGGAGAGCAGGAAGG + Intronic
908110691 1:60894554-60894576 GCTTTCCAGGGAGAACTGTTCGG + Intronic
908791417 1:67786444-67786466 GTCTCCCAAGGAGAACTGGAGGG + Intronic
912360276 1:109089472-109089494 GTCCTCCAAGGCTAACTGGAGGG - Intergenic
913112186 1:115666601-115666623 GCTCCCCAGGGAGAACTGAAAGG + Intronic
913248108 1:116888118-116888140 GTTCTGCAGGGATAAGGGGAAGG + Intergenic
914414505 1:147467794-147467816 GTTCTCCAATAAGAACTGGCTGG - Intergenic
915091439 1:153429005-153429027 ATGCTCCAGGGGGCACTGGAGGG + Intergenic
916119019 1:161511758-161511780 GGTCTCCTGGGAGAGCTGGGAGG - Intronic
918771842 1:188571217-188571239 CTTCTCCTGCAAGAACTGGAAGG - Intergenic
919612557 1:199763173-199763195 GTTCTGCAGGGTGAACTAGGAGG + Intergenic
920385822 1:205569495-205569517 GTTTTCCAGGGAGAGCTGCGGGG - Intronic
920687313 1:208119241-208119263 GGTCTCCAGGAAGAAGTGGCAGG + Intronic
921878706 1:220228999-220229021 GATCTCCAGGGATAAATGTAAGG - Intronic
1064625369 10:17255818-17255840 GTTCTGCAGGAAGTACAGGAAGG - Intergenic
1066013449 10:31215313-31215335 GTTCTAAAAGGAGAAGTGGAAGG - Intergenic
1066338878 10:34509378-34509400 GTTGACCATGGAGAATTGGATGG - Intronic
1067439431 10:46300340-46300362 GGTCTCCAGGGAGCCCAGGAAGG + Intronic
1067478267 10:46579908-46579930 GTTTTCCAAGGAAAACTAGAAGG + Intronic
1067616472 10:47761879-47761901 GTTTTCCAAGGAAAACTAGAAGG - Intergenic
1068796180 10:61082824-61082846 GGTCTGCAGAGAGAAATGGAGGG - Intergenic
1069529806 10:69208643-69208665 GATCTCCAGAAAGAACTAGATGG + Exonic
1070125669 10:73619563-73619585 GTTCTCTAGGGAGAACTGCTGGG + Intronic
1073110051 10:101057078-101057100 GTTATCTAGGGAGAAGAGGAGGG + Intergenic
1073945504 10:108745417-108745439 GTTTTCCCTTGAGAACTGGATGG + Intergenic
1074903459 10:117839575-117839597 GTCCTCCATGGAGAGCTGGGCGG + Intergenic
1077210554 11:1369249-1369271 GTGTGCCAGGGAGAACGGGACGG + Intergenic
1077489648 11:2854981-2855003 GCTGTTCTGGGAGAACTGGATGG - Intergenic
1078288394 11:9981892-9981914 GTCCTCCAGGGAAAAGTTGAGGG - Intronic
1081099543 11:38985626-38985648 GTTCTTCAGGTAGAAATGAAAGG - Intergenic
1081735295 11:45399239-45399261 GTTCTCCAGGGGAAAATAGATGG + Intergenic
1083311237 11:61784821-61784843 CCTCTTCTGGGAGAACTGGATGG + Intronic
1083612139 11:64009408-64009430 GTTCTGCAGGTAGAGCAGGATGG - Intronic
1084185570 11:67469133-67469155 GTCCTCCAGGGACAGCTCGAAGG + Exonic
1089417257 11:118302484-118302506 TTTCTCTAGGGAGAAGTGTAGGG + Intergenic
1089561236 11:119344283-119344305 GTGCTCCATGCAGAACGGGAGGG - Intronic
1091266933 11:134277844-134277866 GGTGCCCAGGGAGTACTGGAGGG + Exonic
1092767847 12:11869559-11869581 GTTGTCCAGGGGGGACCGGAGGG - Exonic
1093096145 12:14974345-14974367 GTTTTGCAGAGAGAATTGGAGGG + Intronic
1094266755 12:28568425-28568447 GTTATTCAGGCACAACTGGAAGG + Intronic
1094360063 12:29620984-29621006 GGTCTCCAGGCAGAACAAGATGG + Intronic
1096415217 12:51406875-51406897 CTTCTGCAGGGAGAACTGCCTGG - Intronic
1096945712 12:55407252-55407274 GTTCTTCAGGTAGAAATGAAAGG - Intergenic
1097054352 12:56240920-56240942 GTCCTCCAGAGAGAACTTGCCGG - Exonic
1099175560 12:79417799-79417821 GTTCTCCAGGTTGAAGTGGGGGG - Intronic
1100278895 12:93098833-93098855 GTTCTCCTGTGAGAACTTCAAGG - Intergenic
1100688910 12:97017813-97017835 GTACTTCAGAGAGAACAGGAAGG + Intergenic
1102599430 12:114017914-114017936 CTGCTTCTGGGAGAACTGGAGGG + Intergenic
1102870621 12:116411202-116411224 GGTCTCCAGGGTAAGCTGGAAGG + Intergenic
1102884034 12:116508398-116508420 GTTCTCCAGGGCGAAACGCAGGG + Intergenic
1103284032 12:119785312-119785334 ATTCTCCTGGGATATCTGGATGG + Intronic
1103369039 12:120404317-120404339 GTTCCCCAGGGAAAACTGGGGGG - Intergenic
1103477203 12:121227521-121227543 GTTCTCCAGGGAGAGAATGAAGG - Intronic
1103978905 12:124723112-124723134 GGTCTTCTGGGAGAACTGGAAGG + Intergenic
1104416539 12:128600510-128600532 GTGCTGCAGCGAGAATTGGATGG + Intronic
1104634673 12:130430269-130430291 ATTCTCCACTGAGGACTGGAGGG - Intronic
1104940238 12:132391874-132391896 GGTCTCCAGGGAGAACGGTGTGG - Intergenic
1106605390 13:31223956-31223978 ATTTTCCATGGAGACCTGGAAGG + Intronic
1107623477 13:42258643-42258665 GTTCTGCAGGGAGAAAATGAAGG - Intergenic
1112726754 13:102313101-102313123 GTTCTCCAGGGAAAAAGGCAGGG + Intronic
1113346526 13:109483251-109483273 GTTCTGCAGGGGGCACTCGACGG + Intergenic
1113382122 13:109813680-109813702 GTTCCTCAGGGGGAACTGGTTGG + Intergenic
1114401900 14:22417877-22417899 AATCTCCAGGAAGAACTGGCTGG - Intergenic
1114727668 14:24955718-24955740 GGTCTCCATGGAGAACTTGCTGG - Intronic
1117114030 14:52491763-52491785 GTTTTCCTGGGAGTTCTGGAGGG - Intronic
1117325518 14:54665658-54665680 GATCTCCAGGTAGAATTGGTTGG + Intronic
1118318162 14:64738013-64738035 GTCCTCCAGAGAGACCTGAAAGG - Intronic
1118716819 14:68565830-68565852 GTTGCACTGGGAGAACTGGATGG - Intronic
1119476261 14:74931531-74931553 GTTCTCCAGGGAGTGGGGGAAGG + Intergenic
1119853374 14:77882011-77882033 GTGGTACGGGGAGAACTGGATGG + Intronic
1121410584 14:93745998-93746020 GTTCTGCAGGGAGAAGGGGAAGG - Intronic
1121893870 14:97626281-97626303 CTTCTCCAGGGAAAACTACAGGG + Intergenic
1122114757 14:99522133-99522155 GTTCTGCAGGGAGTCCTGGTAGG + Exonic
1122340319 14:101023871-101023893 TTTCTCCAGGGAGGTTTGGATGG - Intergenic
1124683162 15:31754924-31754946 GTTCTCCTGGAATAACTGGTTGG + Intronic
1126049547 15:44673754-44673776 ATCCTTCAGGGAGAACTAGAAGG - Intronic
1128147036 15:65337564-65337586 GATCCCCAGGGAGCACTGGGAGG + Intronic
1130984775 15:88837610-88837632 GTTCTCAGGGGAGAGCTGAAAGG - Intronic
1131442020 15:92466682-92466704 TTTCTCCAGAGAGAACCTGAAGG - Exonic
1132093680 15:98966308-98966330 GTTCTCCCTGGAGAACTTCAGGG + Intergenic
1133030722 16:3009813-3009835 GTCCTCCAGGGAAACCGGGACGG - Intergenic
1133175411 16:4010693-4010715 GTGCTCCAGGAAGCACAGGAGGG + Intronic
1133407032 16:5532869-5532891 GGTCTCCAGGCAGAAAGGGAAGG - Intergenic
1133436744 16:5786335-5786357 GTTATCAAGGGACAGCTGGAAGG - Intergenic
1135742171 16:24985346-24985368 GTAGTCCAGGGAGACCTGGTTGG - Intronic
1138710169 16:58962114-58962136 GGTCTCCAGAGGGAACTGGTAGG - Intergenic
1139019333 16:62727815-62727837 CTTTTCCAGGGAGAATTTGATGG - Intergenic
1139344428 16:66293447-66293469 CATCTCCAGGGACAACTGGTAGG - Intergenic
1139705877 16:68740040-68740062 GTTGTCCAGGGAGCAAGGGAAGG + Intronic
1140410964 16:74740101-74740123 GTTCTCCATGGAGCCCTGGAAGG + Exonic
1141578029 16:84977369-84977391 GTTCTCCAAGGAGCAGAGGAGGG + Intronic
1141994962 16:87630438-87630460 GCTCCCCAGGGAGGACTGGCTGG - Intronic
1142389758 16:89791440-89791462 GTGCGCCAGGCAGCACTGGAGGG - Exonic
1143577510 17:7803087-7803109 GTTCTCCAGGGGACACTGGCTGG + Intronic
1144849949 17:18239023-18239045 GTCCCCCTGGGAGAGCTGGATGG - Intronic
1145314966 17:21724799-21724821 CATGTCCAGGGAGAACTGTAGGG - Intergenic
1145713403 17:26996737-26996759 CATGTCCAGGGAGAACTGTAGGG - Intergenic
1147585656 17:41652793-41652815 GTCCTGCAGGGAGGACAGGAAGG - Intergenic
1148863946 17:50618980-50619002 GTGCTCCAGGGAAAAGTGGGAGG - Exonic
1151283284 17:73092357-73092379 CCTCTCCAGGGTGATCTGGAAGG - Intronic
1155328412 18:24689752-24689774 GTTGTCCAGATAGAATTGGAGGG + Intergenic
1156228424 18:35131138-35131160 GCTCTCCAGGGAGAAACTGAGGG - Intronic
1156832938 18:41516711-41516733 GTTCTTTAGGGCTAACTGGAGGG + Intergenic
1157201792 18:45665722-45665744 GTTCCACATGGAGAACTTGAAGG - Intronic
1158599748 18:58847157-58847179 GTTTTTAAGGGAGAACTGGCAGG + Intergenic
1158672215 18:59486636-59486658 GTTCTGCAGGGAGGACTGGCTGG - Intronic
1158782142 18:60664012-60664034 CATCTCCAGGGACACCTGGATGG - Intergenic
1160167481 18:76527230-76527252 GCTCATCAGGGTGAACTGGAAGG + Intergenic
1161347213 19:3774378-3774400 GTACTCCAGGGACAATGGGAAGG + Intergenic
1162026802 19:7899026-7899048 GGTCTCCGGGGAGAACCAGAAGG + Exonic
1162380742 19:10330274-10330296 GTTCTCCAAGGAGAACATGAAGG + Intronic
1164434892 19:28220546-28220568 GTTCTCTAGAGAGAATTAGAAGG - Intergenic
1165856784 19:38883754-38883776 GTTCTAGAGGGAGAGATGGAGGG + Exonic
1167978644 19:53254460-53254482 CTTCTCCAGGGAGAACAGAGGGG - Intronic
1168441158 19:56368367-56368389 GGGCTCCAGGGAGACCTGGGTGG + Intronic
925293987 2:2765891-2765913 GTTCTCAGGTCAGAACTGGAGGG + Intergenic
925590698 2:5506956-5506978 GAGCTCCAGGGAGGAGTGGATGG - Intergenic
925878570 2:8332026-8332048 GGTCTCCTGGGAGAGCTAGAAGG - Intergenic
926418591 2:12675212-12675234 GTTCTCCAGGGACATCTACAAGG - Intergenic
926570509 2:14524632-14524654 ATTCTGAAGGGAGAAGTGGAGGG + Intergenic
928877120 2:36053099-36053121 GTTCTCCTGCAGGAACTGGAAGG - Intergenic
928914276 2:36455095-36455117 ATGGGCCAGGGAGAACTGGAAGG + Intronic
929816449 2:45236691-45236713 GCACTCCAGGGAGAAAGGGAGGG + Intergenic
929881122 2:45838148-45838170 CTTCCCCAGGCAGACCTGGAAGG - Intronic
929945606 2:46369510-46369532 GTTCTCCAAGAACCACTGGAAGG - Intronic
934018024 2:87910324-87910346 TTTCTCCATGCAGTACTGGATGG - Intergenic
937684867 2:124684475-124684497 GCTCTCCAGGGAGAAAAGGATGG - Intronic
937854652 2:126663546-126663568 CTTCTCCATGGAGAACCAGATGG - Intronic
939955115 2:148521386-148521408 GTTCTGCAGTGGGAGCTGGAAGG - Intergenic
944660098 2:201914547-201914569 GTTCTGCAGGACCAACTGGAGGG + Intergenic
946663103 2:222021563-222021585 GTGCTGGAGGGAGACCTGGAAGG + Intergenic
947529714 2:230901102-230901124 TGACTCCAGGGAGAACTGGTGGG + Intergenic
948190168 2:236052050-236052072 GTTCTGCAGAGAGACCAGGAGGG - Intronic
1170429075 20:16260342-16260364 GCTCTCCAGGCAGGAGTGGAAGG - Intergenic
1170644724 20:18187647-18187669 CATCTCCAGGAAGGACTGGAGGG - Exonic
1171782677 20:29435180-29435202 TTTCTCTAGGGAGAACAGTATGG - Intergenic
1172035453 20:32007635-32007657 GCTCTGCAGGGAGCACTGCAGGG + Intergenic
1173226206 20:41163722-41163744 GTTCTCTTTGGAGAACAGGAAGG - Exonic
1173540612 20:43848238-43848260 GTCCTCCAGGGAGAACAGCCTGG + Intergenic
1174099418 20:48115805-48115827 GTTCTCCAGCGGGAAGTGGTTGG + Intergenic
1174310849 20:49652898-49652920 GTGCTCCAGGCAGAAGTGGTCGG + Intronic
1175466305 20:59192861-59192883 GTTCTCCCAGGAGAAGTGGCAGG + Exonic
1175739849 20:61412903-61412925 TTTCTCCAGGGAGACCCTGAGGG + Intronic
1176304862 21:5118074-5118096 GTTGCCCAGGGAGATTTGGAGGG - Intronic
1178916084 21:36706252-36706274 GACCCCCAGGGAGAAATGGAGGG - Intronic
1179852192 21:44143956-44143978 GTTGCCCAGGGAGATTTGGAGGG + Intronic
1179975219 21:44861609-44861631 GTGCTCCAGGCAGAACCGGCAGG - Intronic
1180637184 22:17270480-17270502 GTTGTCCAGGGAGAAATGAAGGG - Intergenic
1181545101 22:23598145-23598167 GTTGGCCAGGGAGGCCTGGAGGG - Intergenic
1181815209 22:25431737-25431759 GTTGGCCAGGGAGGCCTGGAGGG + Intergenic
1181822954 22:25489909-25489931 TTTATTCAGGGAGAAGTGGAGGG - Intergenic
1182409954 22:30176104-30176126 GTGCTCCAGGAAGAAGAGGAAGG + Exonic
950797340 3:15520868-15520890 GCTTTCCAGGGAGAAGTGGAGGG - Intronic
952923852 3:38307459-38307481 GTTCTCCAGGGACCCATGGATGG + Intronic
953260956 3:41338685-41338707 GTTCTCCAGAGAAAACTAGTAGG + Intronic
953707966 3:45245477-45245499 ATTCCACAGGGAGCACTGGATGG + Intergenic
955019328 3:55103942-55103964 GTTCTCTTGGGACAACTGTATGG - Intergenic
955774023 3:62414810-62414832 GACCTCCAGGGAGGACGGGAAGG + Intronic
959387648 3:105732011-105732033 TTTCTTCAGGGAGAAATGCAAGG + Intronic
959446769 3:106450051-106450073 GATCTCCAGGGAGTGCTGAAGGG + Intergenic
965681432 3:171255950-171255972 GTTCTCCAGGAGGAACTCAAAGG + Intronic
965766283 3:172133876-172133898 CCTCTCCATGGAGAAGTGGAGGG + Intronic
966817944 3:183904592-183904614 CTCCTCCAGGGGGCACTGGAGGG + Intergenic
967038154 3:185663533-185663555 CTTTTCCTGGGAGAACTGCAGGG + Intronic
968842403 4:3017068-3017090 GTTCTCCACGGAGCAGTGCAAGG + Intronic
968977717 4:3830638-3830660 GTTCTCCAGGAAGCAGAGGAGGG + Intergenic
969295456 4:6268116-6268138 GTACTCCAGGAAGAGCTGGAGGG - Intergenic
969628592 4:8321908-8321930 GTTACTCAGGGAGAACTGGGAGG - Intergenic
971324982 4:25636344-25636366 GTTCCCTAGGGTGAACTGGGAGG - Intergenic
977310194 4:95376903-95376925 GTTGTAAAGGGAGCACTGGAGGG - Intronic
977340338 4:95749818-95749840 GTTCTCCAGGGAGCACCAGAAGG - Intergenic
977350232 4:95875225-95875247 GTTCTACAGGGAGCAGTGCATGG + Intergenic
978400014 4:108321534-108321556 GTTCTGAAGGGAGATCTGGATGG - Intergenic
981872221 4:149500032-149500054 TTTCTCCAGAGACAGCTGGAAGG - Intergenic
982485252 4:155958445-155958467 GATCTGCAGGGAGAAGTGGCTGG + Intergenic
983439281 4:167760852-167760874 ACTCTCCAGGGAAAATTGGATGG - Intergenic
988437881 5:31196560-31196582 GAACTCCAGGGAGAAATGCATGG - Intronic
991164610 5:63549796-63549818 GTTTTCCAAGGGGAACTCGATGG - Intergenic
991544609 5:67767623-67767645 GTTCTTCTGGGGGACCTGGAAGG - Intergenic
999438057 5:151579787-151579809 GTTCTGAAGGTAGAACTAGATGG + Intergenic
999456897 5:151724435-151724457 GTTCCCCAGGGATAGCTGGCTGG + Intergenic
1001193891 5:169654430-169654452 GATCTGCAGGGAGAGCTGGGGGG - Exonic
1004695330 6:18027855-18027877 GGTTTCCAGGGAGAGTTGGAGGG + Intergenic
1006739051 6:36294335-36294357 GTTCTCCAGGGAGAACTGGAAGG - Exonic
1006902727 6:37513437-37513459 CTTCCCAAGGGAGAAGTGGAAGG - Intergenic
1007582218 6:42966361-42966383 GTGCTCCAGGGGGAGCTGAATGG + Exonic
1007623622 6:43229660-43229682 CTTGTCCAGGCAGAACTCGAGGG + Intergenic
1007758340 6:44115772-44115794 GGCCTCCAGGGAGAATTGGGAGG - Intronic
1007961100 6:45960439-45960461 TCTCACCAGGGAGAACTAGAGGG + Intronic
1008685768 6:53925029-53925051 GTTCTCAAGGCAGAACTGTCTGG - Intergenic
1012044267 6:94249286-94249308 TTTCTCCAGTGAGAACTGCCAGG + Intergenic
1012160276 6:95876173-95876195 GTTCTCCAGATATAGCTGGAAGG - Intergenic
1012575720 6:100795174-100795196 GTTTTCCTGGCAGAACTGGTTGG + Intronic
1012965218 6:105666664-105666686 GTTGAACAAGGAGAACTGGATGG + Intergenic
1013673188 6:112428150-112428172 AGCCTCCAGGCAGAACTGGAGGG + Intergenic
1014023955 6:116622952-116622974 TTTCTCCAGGGACATTTGGAAGG + Exonic
1014713335 6:124834979-124835001 TTTCTCCAAGGAGAAATGTATGG + Intergenic
1016535189 6:145102262-145102284 GTCTTCCAGGGATAACTTGAGGG - Intergenic
1016760717 6:147733606-147733628 GTTCTACCTGGAGAATTGGATGG - Intronic
1017714781 6:157201267-157201289 GTTCTCCAGGGAGCGCTGGAAGG - Exonic
1018429509 6:163712496-163712518 GTTCCCCAGGGAGTGTTGGAGGG + Intergenic
1018450372 6:163901680-163901702 GTTCTCCAGGGAGAGCGCGGGGG + Intergenic
1018615545 6:165683208-165683230 GCTCTCCAGTGAGGAGTGGAAGG + Intronic
1018668920 6:166163777-166163799 ATTCTCCAGGCAGCACTGGAAGG + Intronic
1018855422 6:167670885-167670907 GTTTTCCGCGGAGACCTGGAAGG + Intergenic
1019163215 6:170082560-170082582 TTTCTCTGGGGAGAACTGAATGG - Intergenic
1019479571 7:1260279-1260301 TTTCTCCAGGGACAAGTGGAGGG - Intergenic
1019644111 7:2120033-2120055 GGTCCCCAGGGAGAGCTGGAGGG - Intronic
1019659471 7:2215955-2215977 CTGCTCCAGGAAGAGCTGGAAGG - Exonic
1020094737 7:5362004-5362026 GTCCTCCAGGGAGGACTTCATGG + Exonic
1021406490 7:20273698-20273720 CTTCTCCAGGAAGATCTGGTGGG - Intergenic
1021419761 7:20432644-20432666 CTTCTCCAGGCAGAACAGCAAGG - Intergenic
1021799538 7:24290492-24290514 AGTCTCTAGGGAGAACTTGATGG - Intronic
1022812347 7:33882240-33882262 GTTGGCCAGTGAGAATTGGAAGG + Intergenic
1028604355 7:92639507-92639529 ATTTTCCAGTGAGAACAGGAAGG - Intronic
1029205880 7:98869365-98869387 GTCCCCCAGGGAGCACGGGATGG - Intronic
1030638857 7:111981275-111981297 TTTCACCAGGGAGAGCTGGGAGG - Intronic
1032931899 7:136681850-136681872 GTTTTCTAAGTAGAACTGGAAGG + Intergenic
1034129244 7:148699684-148699706 GTTCTCCTGGGAGAGCGGGCCGG + Intronic
1034130081 7:148707679-148707701 GTTCTCCATGGACACCGGGAAGG - Intronic
1034457447 7:151178716-151178738 TTTCTCCAGGGACCCCTGGAAGG - Intronic
1034632442 7:152541015-152541037 GTTCTCCAGGGAGCAGTGGGAGG - Intergenic
1034714489 7:153228611-153228633 GCACTCCAGGCAGAACTGGCTGG - Intergenic
1034831338 7:154310650-154310672 GTTCTCCATGGAGCATTTGAAGG - Intronic
1035785216 8:2254495-2254517 GGTCTCCAGGGAGAAGCGGCGGG - Intergenic
1035807592 8:2467221-2467243 GGTCTCCAGGGAGAAGCGGCGGG + Intergenic
1036754639 8:11464221-11464243 CTTCTCCAGAGAGAAGTGGTAGG + Intronic
1037747181 8:21655165-21655187 GTACTCCAGGGACAAATGAATGG - Intergenic
1038885379 8:31657376-31657398 GTTCTCCATGGTCAACTAGAGGG - Intronic
1040896845 8:52376739-52376761 GTTCTCTAGGGAGGACAGGATGG + Intronic
1041455728 8:58057237-58057259 GCTCTCCAGGGTGACCTGGCTGG + Intronic
1045035455 8:98173273-98173295 GTTGTCCAGGGAGTGCTGCAGGG + Intergenic
1045084018 8:98660969-98660991 GTTCTTCAGGTAGAAATGAAAGG + Intronic
1047237127 8:123051769-123051791 GTTCTCCTGGGAGAACTGGGAGG - Intronic
1047348199 8:124048924-124048946 ATTATCCAGGGAAGACTGGAAGG - Intronic
1049261395 8:141641111-141641133 GTGCTCCAGGGAAAATGGGAGGG - Intergenic
1051506040 9:17828846-17828868 GTTGTCCAGGGAAAACTGTTAGG - Intergenic
1055813531 9:80179032-80179054 GTTCTGCAGGGTGTACAGGAAGG + Intergenic
1057012448 9:91617138-91617160 GGTCTTCAGGAAGCACTGGATGG - Intronic
1057120410 9:92567154-92567176 GTTCTACAGGGTGAAATGAAAGG + Intronic
1058067807 9:100568169-100568191 GATATCCAGGGAGAACTGCAGGG + Intronic
1058936137 9:109771411-109771433 GTTCTCTGGGGAGGAGTGGAGGG + Intronic
1059203176 9:112437927-112437949 GTTCTACGGAGAGAACTGGGTGG - Intronic
1059635044 9:116162090-116162112 ATTATCCAGGGAGAACTCGAGGG + Intronic
1060066395 9:120504841-120504863 TTTCTCTAGGTGGAACTGGAGGG - Intronic
1060209353 9:121700310-121700332 GTCCTCCAGGGGGCACTGGGCGG + Intronic
1062679528 9:137771156-137771178 GCTCTGAGGGGAGAACTGGAGGG - Intronic
1186722607 X:12321955-12321977 GTTCTGCAGGGTGATGTGGAAGG + Intronic
1187262164 X:17695764-17695786 GTTCTCCAGGGGGAACTCACAGG + Intronic
1188456692 X:30374290-30374312 TTACTCTAGGGAGAGCTGGATGG + Intergenic
1189427215 X:40912296-40912318 GCTCCCTAGGGAGAACTGAAGGG + Intergenic
1190474266 X:50812350-50812372 TTTCTCCAGAGAACACTGGAGGG + Intronic
1195254866 X:103081343-103081365 CTTCTCCCGGGAGAAGTGAAGGG + Intronic
1195975380 X:110520942-110520964 GGTGTCCAGGGGAAACTGGAGGG - Intergenic
1198327246 X:135586129-135586151 GTTCTTCAGGGTGAAATGAAAGG + Intergenic
1199126508 X:144128685-144128707 TTTCTCCATGCAGTACTGGATGG + Intergenic