ID: 1006739054

View in Genome Browser
Species Human (GRCh38)
Location 6:36294347-36294369
Sequence CATCCTGGCGATGTTCTCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 131}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006739054_1006739074 30 Left 1006739054 6:36294347-36294369 CCCTGGAGAACATCGCCAGGATG 0: 1
1: 0
2: 1
3: 6
4: 131
Right 1006739074 6:36294400-36294422 GTGAGAGGCAGGAGGGGTCTGGG 0: 1
1: 0
2: 3
3: 60
4: 668
1006739054_1006739068 19 Left 1006739054 6:36294347-36294369 CCCTGGAGAACATCGCCAGGATG 0: 1
1: 0
2: 1
3: 6
4: 131
Right 1006739068 6:36294389-36294411 CGGACCTGGTGGTGAGAGGCAGG 0: 1
1: 0
2: 2
3: 12
4: 233
1006739054_1006739060 5 Left 1006739054 6:36294347-36294369 CCCTGGAGAACATCGCCAGGATG 0: 1
1: 0
2: 1
3: 6
4: 131
Right 1006739060 6:36294375-36294397 CGCATTGTTCCCCCCGGACCTGG 0: 1
1: 0
2: 0
3: 0
4: 37
1006739054_1006739073 29 Left 1006739054 6:36294347-36294369 CCCTGGAGAACATCGCCAGGATG 0: 1
1: 0
2: 1
3: 6
4: 131
Right 1006739073 6:36294399-36294421 GGTGAGAGGCAGGAGGGGTCTGG 0: 1
1: 1
2: 5
3: 102
4: 1005
1006739054_1006739069 22 Left 1006739054 6:36294347-36294369 CCCTGGAGAACATCGCCAGGATG 0: 1
1: 0
2: 1
3: 6
4: 131
Right 1006739069 6:36294392-36294414 ACCTGGTGGTGAGAGGCAGGAGG 0: 1
1: 0
2: 3
3: 72
4: 565
1006739054_1006739072 24 Left 1006739054 6:36294347-36294369 CCCTGGAGAACATCGCCAGGATG 0: 1
1: 0
2: 1
3: 6
4: 131
Right 1006739072 6:36294394-36294416 CTGGTGGTGAGAGGCAGGAGGGG 0: 1
1: 2
2: 8
3: 86
4: 835
1006739054_1006739057 -1 Left 1006739054 6:36294347-36294369 CCCTGGAGAACATCGCCAGGATG 0: 1
1: 0
2: 1
3: 6
4: 131
Right 1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG 0: 1
1: 0
2: 1
3: 9
4: 66
1006739054_1006739071 23 Left 1006739054 6:36294347-36294369 CCCTGGAGAACATCGCCAGGATG 0: 1
1: 0
2: 1
3: 6
4: 131
Right 1006739071 6:36294393-36294415 CCTGGTGGTGAGAGGCAGGAGGG 0: 1
1: 0
2: 3
3: 87
4: 709
1006739054_1006739061 8 Left 1006739054 6:36294347-36294369 CCCTGGAGAACATCGCCAGGATG 0: 1
1: 0
2: 1
3: 6
4: 131
Right 1006739061 6:36294378-36294400 ATTGTTCCCCCCGGACCTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 66
1006739054_1006739064 15 Left 1006739054 6:36294347-36294369 CCCTGGAGAACATCGCCAGGATG 0: 1
1: 0
2: 1
3: 6
4: 131
Right 1006739064 6:36294385-36294407 CCCCCGGACCTGGTGGTGAGAGG 0: 1
1: 0
2: 0
3: 22
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006739054 Original CRISPR CATCCTGGCGATGTTCTCCA GGG (reversed) Exonic
901712216 1:11124574-11124596 CATCCTGGCGCAGATCTTCATGG + Exonic
905747164 1:40428006-40428028 CATCCTGGCTATGTCCAACATGG + Intergenic
907018787 1:51044440-51044462 TCTTCTGGCTATGTTCTCCATGG + Intergenic
910262077 1:85302681-85302703 CATCCTGGCTGTGCTCCCCATGG + Intergenic
920849085 1:209616475-209616497 CATCCTGTCCATCATCTCCATGG + Exonic
921878056 1:220221200-220221222 CCTCATGGCTATATTCTCCAGGG + Intronic
922261824 1:223950451-223950473 CATACTGTCCATGTTCTCAAGGG - Intergenic
922803111 1:228373040-228373062 GATCCGGGAGATGTGCTCCACGG - Exonic
1067049139 10:43001997-43002019 GCTCCTGGCGAGGCTCTCCAGGG - Intergenic
1067140164 10:43649671-43649693 CATCCTGGAGCTGTTCTGCCTGG + Intergenic
1077087660 11:762730-762752 CATCCTGGGGTTGATCCCCAAGG - Intronic
1077282180 11:1750827-1750849 CACCCTGGCCATGCTCTCCCTGG + Intronic
1081778875 11:45696158-45696180 CAACCTGGCCATGTTGCCCAGGG - Intergenic
1081879365 11:46434891-46434913 CATCCTGGCAGTGTACTCCCTGG - Exonic
1082162572 11:48900849-48900871 CATCCTGACCATGTGGTCCAGGG + Intergenic
1082174968 11:49048847-49048869 CATCCTGACTATGTGGTCCAGGG + Intergenic
1082238850 11:49851886-49851908 CATCCTGACCATGTGGTCCAGGG - Intergenic
1082243293 11:49892443-49892465 CATCCTGACCATGTGGTCCAGGG + Intergenic
1082657790 11:55873268-55873290 CATCCTGACCATGTGGTCCAGGG + Intergenic
1082991976 11:59214535-59214557 CAACCTGGTGATTTGCTCCAAGG + Intergenic
1084719487 11:70895192-70895214 CATCCTCGTGCGGTTCTCCAAGG + Intronic
1086690804 11:89787239-89787261 CATCCTGACTATGTGGTCCAGGG - Intergenic
1086697719 11:89864266-89864288 CATCCTGACCATGTGGTCCAGGG + Intergenic
1086708442 11:89980222-89980244 CATCCTGACCATGTGGTCCAGGG - Intergenic
1086714996 11:90052416-90052438 CATCCTGACTATGTGGTCCAGGG + Intergenic
1086909538 11:92456860-92456882 CATCCTAGCGCTGTTCACCATGG - Intronic
1088551053 11:111012641-111012663 TATCCTGGCGCTGTCCTGCACGG - Intergenic
1090279710 11:125445347-125445369 CAGCCTGGGGAGGGTCTCCAGGG + Intergenic
1091147283 11:133290710-133290732 CATGCTGCCCATGTACTCCATGG - Intronic
1099878996 12:88443288-88443310 TTTCCTGGCACTGTTCTCCATGG - Intergenic
1104844106 12:131838320-131838342 CATCCTGGGTCAGTTCTCCAGGG + Exonic
1104863909 12:131941533-131941555 CATCCTGGAGATGTACTGCGAGG + Exonic
1105503487 13:20991330-20991352 CATCTTGCTGATGTACTCCAGGG + Exonic
1110477428 13:75932842-75932864 CATTCTGGCGCTGTTATGCATGG + Intergenic
1110702139 13:78561315-78561337 CAGCTTGGCGATGATCTGCAGGG - Intergenic
1113809450 13:113129480-113129502 CATCCTGGCGAGGGTCACGAGGG + Exonic
1115973711 14:38973982-38974004 CATGCTGGAGATGGTCCCCAGGG + Intergenic
1117799288 14:59426943-59426965 CAGCCTTGCCATGTTCTTCATGG + Intergenic
1121830403 14:97046564-97046586 CATCCTGGGGAAATTCTCTAGGG + Intergenic
1124591850 15:31060906-31060928 CTTCCTGGAGATCATCTCCAGGG - Intronic
1126072268 15:44875447-44875469 CCTCCTGCCTCTGTTCTCCAAGG - Intergenic
1128901015 15:71422979-71423001 CAGCCTGGCAGTGCTCTCCATGG - Intronic
1130661195 15:85832659-85832681 CTTCCTGGCGCTGCTCTTCACGG + Intergenic
1133333465 16:4990849-4990871 CTTCATGGCGATCTTCTCCAAGG - Exonic
1133530535 16:6651262-6651284 TAGCCTGGCCATGCTCTCCATGG - Intronic
1137973847 16:53013270-53013292 CTTCCCTGCGATGTTCTCCCTGG - Intergenic
1141073127 16:80976504-80976526 AATTCTGTCCATGTTCTCCAGGG + Intronic
1141753718 16:85977157-85977179 CATCCTTGTGATGTTGGCCATGG + Intergenic
1143974880 17:10822334-10822356 CATCCTGTCCATTTTCTCCCAGG + Intergenic
1145409496 17:22645750-22645772 CATCCTGGCGAGTCTCTCTAAGG + Intergenic
1151933828 17:77249218-77249240 AATCCTGGCGATCTTCGCCCAGG + Intergenic
1152039170 17:77892121-77892143 AATCCAGGGGAGGTTCTCCAAGG + Intergenic
1152123752 17:78434196-78434218 CACCCTGGAGATGTGCACCAAGG - Exonic
1152315261 17:79576772-79576794 CATCATTTCCATGTTCTCCATGG - Intergenic
1152526955 17:80893803-80893825 CATCTTGTCGATGGTCTCGAAGG - Exonic
1152755736 17:82086272-82086294 CAGGCTGGGCATGTTCTCCACGG + Exonic
1153323380 18:3794498-3794520 CATCCTGGGTGGGTTCTCCACGG - Intronic
1156270278 18:35524235-35524257 CATCCATGCAATTTTCTCCATGG + Intergenic
1166549601 19:43656512-43656534 CATCCAGGCACTGTTCTTCAGGG + Exonic
926494830 2:13573151-13573173 CCCCCTGGGGTTGTTCTCCATGG - Intergenic
927473851 2:23397142-23397164 TCTCCTGACGAGGTTCTCCACGG - Intronic
929548758 2:42875657-42875679 CATCCTGGTGCCGTTCTCCAGGG + Intergenic
929559882 2:42949554-42949576 CATCTGGGCGCAGTTCTCCAAGG - Intergenic
931490696 2:62743392-62743414 CATCTTCTCTATGTTCTCCAAGG + Intronic
934588504 2:95526627-95526649 CATCCTGACCATGTGGTCCAGGG - Intergenic
937972935 2:127564418-127564440 CACACAGGCCATGTTCTCCATGG - Intronic
940433006 2:153616016-153616038 TATCCTGGAGATATTCCCCAGGG + Intergenic
946126671 2:217568596-217568618 CCTCCTGGTCATGTTCTTCAAGG - Intronic
946568901 2:220999462-220999484 CATCCTGGAAATGTATTCCAAGG + Intergenic
947897733 2:233691366-233691388 CATCCTGGTTATGTTCCCCATGG + Intronic
948211006 2:236193187-236193209 CATCCTGCCGGTGTCCTCCGGGG + Intergenic
948605880 2:239134442-239134464 CATCCTGGCTGTGCTTTCCAGGG - Exonic
1172105614 20:32515600-32515622 CATCCTGGCGTTTTTCTCACTGG - Intronic
1172108678 20:32532370-32532392 CATCCTGGCGTTCTTCCCCTAGG - Intronic
1172292442 20:33785844-33785866 TACCTTGGCGATGTTCCCCAAGG + Intronic
1172312088 20:33926606-33926628 CATCCTTGCGATGCTCTCACGGG + Intergenic
1173238723 20:41273629-41273651 CATCTTGGCACTGTTCTCAAAGG + Intronic
1173388470 20:42609937-42609959 CCTCCAGGAGCTGTTCTCCAAGG + Intronic
1174082917 20:47983535-47983557 CCTCCTGGGAATGTTCTCTAAGG + Intergenic
1175132894 20:56802884-56802906 CCTCCCGGGGATGTTCCCCACGG + Intergenic
1175986979 20:62768914-62768936 CAGCCTGGCCATGGTTTCCATGG - Intergenic
1176137823 20:63532598-63532620 CATCCTGGCGCTGTACGCCGTGG - Exonic
1178065876 21:28903755-28903777 CCTCCCGGCGAACTTCTCCACGG + Intergenic
1185393826 22:50576973-50576995 CAGCATGGCCATCTTCTCCACGG - Exonic
952836460 3:37606577-37606599 AATCCTGGTGATGATCTTCATGG - Intronic
958851630 3:99333484-99333506 CATCTTTGGGATTTTCTCCATGG - Intergenic
959568242 3:107854668-107854690 AATCCTGCTGATGCTCTCCATGG - Intergenic
960702256 3:120450587-120450609 CGTCCTGGGGATGCTCTCCCGGG - Intronic
967249594 3:187523146-187523168 CATTATGGCGATTTTATCCATGG + Intergenic
971625237 4:28911222-28911244 CATCCTGAAGATTTTCTGCAAGG + Intergenic
973373927 4:49275373-49275395 CGCCCTGGCGATGCTCTCCTTGG + Intergenic
973383485 4:49334866-49334888 CGCCCTGGCGATGCTCTCCTTGG - Intergenic
973387090 4:49519880-49519902 CGCCCTGGCGATGCTCTCCTTGG - Intergenic
976526750 4:86101058-86101080 CATCCTGGGGATGGGCTACAAGG - Exonic
976998858 4:91469603-91469625 CAACCTAGGGAAGTTCTCCAGGG - Intronic
978705875 4:111710589-111710611 TATCCTGGCTATGTTGGCCAGGG - Intergenic
983636114 4:169899434-169899456 TATCCTGGCTGTGATCTCCATGG + Intergenic
985053224 4:186013557-186013579 CATCCTGTAGATGTTCTGGAGGG - Intergenic
985682076 5:1261118-1261140 CATCCCACCGATGTCCTCCAGGG + Intronic
985930295 5:3051757-3051779 CATCATGGCTATGTGTTCCAGGG - Intergenic
986329899 5:6710326-6710348 CATTCTGCCAATGTTCACCAAGG + Intergenic
986661491 5:10064072-10064094 CATCCTGTCAATATTCTGCAGGG + Intergenic
992910617 5:81393215-81393237 CATCCTGGCGAGTCTCTCTAAGG - Intronic
996959379 5:129227574-129227596 CATCCTTGAGATTTTCTCCAGGG + Intergenic
997353507 5:133247751-133247773 GATACTGGCTATGTTCACCATGG + Intronic
1006739054 6:36294347-36294369 CATCCTGGCGATGTTCTCCAGGG - Exonic
1007606129 6:43119453-43119475 CACCCTGGCACTGTTCTCCATGG + Intronic
1007935064 6:45725774-45725796 CAACCTAGTCATGTTCTCCAGGG - Intergenic
1007993364 6:46280650-46280672 CATCTTGGCAGTATTCTCCAAGG - Intronic
1011590223 6:88964318-88964340 CTTCGTGGCGTTGTTCTCCTTGG + Intergenic
1012387833 6:98702627-98702649 CATCATGCTGATTTTCTCCAAGG + Intergenic
1013467648 6:110431203-110431225 CATCCTGGCGCCGTTCTCTGTGG - Exonic
1014523335 6:122471707-122471729 CGTCCTGGGGCTGTGCTCCATGG - Exonic
1018376729 6:163219845-163219867 CATCCTGGCCCCGGTCTCCATGG + Intronic
1022590027 7:31652717-31652739 CATCCTGGTGCTGTTCTCCAAGG - Intronic
1030299968 7:107965031-107965053 CAAGCTGGAGATGTTCTTCAGGG - Intronic
1033555164 7:142482667-142482689 CAGCCTGGAGGTCTTCTCCATGG - Intergenic
1035091753 7:156318875-156318897 CTTCCTGGCTGTGTGCTCCATGG - Intergenic
1037797094 8:22005175-22005197 GATCCTGGCTCTTTTCTCCAGGG + Exonic
1039384893 8:37126727-37126749 CAGCCTGGAAATGTGCTCCAGGG + Intergenic
1042795787 8:72662197-72662219 CCTCCTGGCATTGATCTCCAGGG + Intronic
1049349082 8:142154468-142154490 CAGCCTGGCAAAGTCCTCCATGG + Intergenic
1049492176 8:142911230-142911252 CATCCTCGGGACCTTCTCCAGGG + Exonic
1050782614 9:9356793-9356815 CATTCTGTTGATGATCTCCAAGG + Intronic
1051345850 9:16150682-16150704 CATCCTGTTGATGGTTTCCAGGG + Intergenic
1055871768 9:80889048-80889070 CAACCTGTCCATGTTCTTCAGGG - Intergenic
1057019491 9:91685561-91685583 GATCCTGGAGTTGTTGTCCAAGG - Intronic
1058807392 9:108605586-108605608 ACTCCTGGAGATGTTGTCCAAGG + Intergenic
1060342743 9:122791339-122791361 GATCCTGAAGATGTTCTCCTGGG - Intergenic
1061195692 9:129106050-129106072 CATCCTGCTGCTGTTCACCACGG - Intronic
1062160512 9:135077039-135077061 CCTCCTGGAGAGGTTCTGCATGG + Intronic
1062516788 9:136940874-136940896 GAGCCTGGCGATGTCCTCAAGGG + Exonic
1196440205 X:115712685-115712707 CATCATAGCCATGTTCTCAATGG - Intergenic
1196605154 X:117648647-117648669 GCTCCTGGGGATGTTCTTCATGG + Intergenic
1198841066 X:140858812-140858834 TAGCCTGGCAATATTCTCCATGG + Intergenic
1199387121 X:147235998-147236020 CAGTCTGAAGATGTTCTCCAGGG + Intergenic
1200915465 Y:8567465-8567487 CAGCCTGCCTGTGTTCTCCAGGG + Intergenic
1200923128 Y:8630731-8630753 CAGCCTGCCTATGTCCTCCAGGG + Intergenic
1201378927 Y:13351253-13351275 CATGGTAGCGGTGTTCTCCAGGG + Intronic