ID: 1006739055

View in Genome Browser
Species Human (GRCh38)
Location 6:36294348-36294370
Sequence TCATCCTGGCGATGTTCTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 109}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006739055_1006739072 23 Left 1006739055 6:36294348-36294370 CCTGGAGAACATCGCCAGGATGA 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1006739072 6:36294394-36294416 CTGGTGGTGAGAGGCAGGAGGGG 0: 1
1: 2
2: 8
3: 86
4: 835
1006739055_1006739074 29 Left 1006739055 6:36294348-36294370 CCTGGAGAACATCGCCAGGATGA 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1006739074 6:36294400-36294422 GTGAGAGGCAGGAGGGGTCTGGG 0: 1
1: 0
2: 3
3: 60
4: 668
1006739055_1006739057 -2 Left 1006739055 6:36294348-36294370 CCTGGAGAACATCGCCAGGATGA 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG 0: 1
1: 0
2: 1
3: 9
4: 66
1006739055_1006739060 4 Left 1006739055 6:36294348-36294370 CCTGGAGAACATCGCCAGGATGA 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1006739060 6:36294375-36294397 CGCATTGTTCCCCCCGGACCTGG 0: 1
1: 0
2: 0
3: 0
4: 37
1006739055_1006739073 28 Left 1006739055 6:36294348-36294370 CCTGGAGAACATCGCCAGGATGA 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1006739073 6:36294399-36294421 GGTGAGAGGCAGGAGGGGTCTGG 0: 1
1: 1
2: 5
3: 102
4: 1005
1006739055_1006739075 30 Left 1006739055 6:36294348-36294370 CCTGGAGAACATCGCCAGGATGA 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1006739075 6:36294401-36294423 TGAGAGGCAGGAGGGGTCTGGGG 0: 1
1: 0
2: 8
3: 95
4: 746
1006739055_1006739064 14 Left 1006739055 6:36294348-36294370 CCTGGAGAACATCGCCAGGATGA 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1006739064 6:36294385-36294407 CCCCCGGACCTGGTGGTGAGAGG 0: 1
1: 0
2: 0
3: 22
4: 254
1006739055_1006739071 22 Left 1006739055 6:36294348-36294370 CCTGGAGAACATCGCCAGGATGA 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1006739071 6:36294393-36294415 CCTGGTGGTGAGAGGCAGGAGGG 0: 1
1: 0
2: 3
3: 87
4: 709
1006739055_1006739069 21 Left 1006739055 6:36294348-36294370 CCTGGAGAACATCGCCAGGATGA 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1006739069 6:36294392-36294414 ACCTGGTGGTGAGAGGCAGGAGG 0: 1
1: 0
2: 3
3: 72
4: 565
1006739055_1006739068 18 Left 1006739055 6:36294348-36294370 CCTGGAGAACATCGCCAGGATGA 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1006739068 6:36294389-36294411 CGGACCTGGTGGTGAGAGGCAGG 0: 1
1: 0
2: 2
3: 12
4: 233
1006739055_1006739061 7 Left 1006739055 6:36294348-36294370 CCTGGAGAACATCGCCAGGATGA 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1006739061 6:36294378-36294400 ATTGTTCCCCCCGGACCTGGTGG 0: 1
1: 0
2: 0
3: 1
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006739055 Original CRISPR TCATCCTGGCGATGTTCTCC AGG (reversed) Exonic
902779236 1:18693740-18693762 TCCTCCTGCAGCTGTTCTCCTGG + Intronic
903747478 1:25597707-25597729 TCAGCCTGTTGATGTTCTCTGGG + Intergenic
909685762 1:78346641-78346663 TCATCTTAGCCATGTGCTCCTGG - Intronic
913111773 1:115663720-115663742 TGATCCTGGCAATGTCCTCTTGG - Exonic
920447621 1:206031137-206031159 TCATCCTGAAGATGGTCTCATGG - Intergenic
921878054 1:220221199-220221221 TCCTCATGGCTATATTCTCCAGG + Intronic
922294572 1:224238358-224238380 TCAGCCTGGCAAAGTGCTCCAGG + Intronic
922673818 1:227537967-227537989 TCATCATTGCTATATTCTCCTGG + Intergenic
924957697 1:248945072-248945094 CCGCCCTGGCGATGCTCTCCGGG - Intergenic
1065350685 10:24793237-24793259 TGATCCTGCCCTTGTTCTCCTGG - Intergenic
1067551472 10:47239398-47239420 TCACCCTTGGGATGTTCTCTGGG + Intergenic
1074003508 10:109395068-109395090 TCATGTTGGGGAAGTTCTCCTGG - Intergenic
1076216112 10:128694702-128694724 TCATCCTGATGGTTTTCTCCAGG - Intergenic
1082162571 11:48900848-48900870 TCATCCTGACCATGTGGTCCAGG + Intergenic
1082174967 11:49048846-49048868 TCATCCTGACTATGTGGTCCAGG + Intergenic
1082238851 11:49851887-49851909 TCATCCTGACCATGTGGTCCAGG - Intergenic
1082243292 11:49892442-49892464 TCATCCTGACCATGTGGTCCAGG + Intergenic
1082657789 11:55873267-55873289 TCATCCTGACCATGTGGTCCAGG + Intergenic
1084727725 11:70952928-70952950 TCATCAGGGCCATGTTCCCCAGG + Intronic
1086690805 11:89787240-89787262 TCATCCTGACTATGTGGTCCAGG - Intergenic
1086697718 11:89864265-89864287 TCATCCTGACCATGTGGTCCAGG + Intergenic
1086708443 11:89980223-89980245 TCATCCTGACCATGTGGTCCAGG - Intergenic
1086714995 11:90052415-90052437 TCATCCTGACTATGTGGTCCAGG + Intergenic
1104745459 12:131207653-131207675 TCTTCCTGGCCCCGTTCTCCAGG + Intergenic
1104788881 12:131469456-131469478 TCTTCCTGGCCCCGTTCTCCAGG - Intergenic
1107147288 13:37072169-37072191 AAATCCTGGCGATGTTCTGCAGG - Intergenic
1109964020 13:69668312-69668334 CTATGCTGGCGAAGTTCTCCTGG - Intergenic
1110285134 13:73741141-73741163 TCATCCTGACAATGTTCCCATGG + Intronic
1110702140 13:78561316-78561338 TCAGCTTGGCGATGATCTGCAGG - Intergenic
1111960790 13:94807818-94807840 TTATCCTGGAGAGGTTATCCTGG - Intergenic
1115039541 14:28906875-28906897 CCATCCCAGTGATGTTCTCCTGG - Intergenic
1117105564 14:52394471-52394493 TCATCTTGGAGATGTGCCCCAGG + Intergenic
1121830402 14:97046563-97046585 TCATCCTGGGGAAATTCTCTAGG + Intergenic
1122319558 14:100845595-100845617 TCCGCCTGGCGGTGTGCTCCGGG - Intergenic
1122999425 14:105284485-105284507 TCACCCTGGCTGTTTTCTCCTGG - Intronic
1125372572 15:38994227-38994249 TCCTCCTGGTGATGCCCTCCGGG + Intergenic
1125528311 15:40393663-40393685 TCATCTTGGCCATGATCTTCTGG + Exonic
1131792172 15:95976627-95976649 TCATCCTGATAATGTTCTTCTGG - Intergenic
1132573841 16:655918-655940 GCATCCAGGCGAGGCTCTCCCGG - Intronic
1133803284 16:9102231-9102253 ACATACTGGTGATGTTCTGCTGG + Intronic
1136294593 16:29294492-29294514 TTCTCCTGGCGTTTTTCTCCTGG + Intergenic
1142100498 16:88268536-88268558 TTCTCCTGGCGTTTTTCTCCTGG + Intergenic
1154057508 18:11025543-11025565 TTATCCTGGCGATCTTCTCCTGG + Intronic
1154499076 18:14985489-14985511 CCGCCCTGGCGATGCTCTCCGGG + Intergenic
1156337136 18:36182103-36182125 TCTTCCTGGCGCTGTCTTCCTGG - Intergenic
1159797349 18:72861170-72861192 TCAACCTCTCGATGTTCCCCAGG + Intronic
1160552644 18:79704841-79704863 ACAGCTTGGCGATCTTCTCCAGG - Exonic
1162950664 19:14070511-14070533 TCACGCTGGCGCCGTTCTCCTGG - Intergenic
1164507882 19:28874409-28874431 TCATCCTGGGGACATTCTCATGG - Intergenic
925126533 2:1461181-1461203 TCATCCTGGGCACGTTCTGCTGG + Intronic
928574155 2:32637963-32637985 TCATCCTGGCCATGTCCTTGAGG + Intronic
929192773 2:39154999-39155021 TTATACTGGTGATGTTCACCAGG + Intergenic
929548757 2:42875656-42875678 ACATCCTGGTGCCGTTCTCCAGG + Intergenic
932753849 2:74391584-74391606 TCAGCCTAGCATTGTTCTCCTGG - Intronic
934588505 2:95526628-95526650 TCATCCTGACCATGTGGTCCAGG - Intergenic
934755325 2:96820522-96820544 TCCTCCTGGCCAGCTTCTCCTGG - Intronic
935138192 2:100326341-100326363 TGATTGTGGCGATGTTCTCATGG + Intergenic
935674027 2:105578913-105578935 TCATCCTGGAAATGAGCTCCGGG - Intergenic
937231846 2:120402650-120402672 TCATCCCGGCCATGATCCCCTGG - Intergenic
938498041 2:131813575-131813597 CCGCCCTGGCGATGCTCTCCGGG + Intergenic
938794608 2:134707072-134707094 ACATCCTGGCGGTGTTCTGAGGG - Intronic
946174018 2:217911776-217911798 TCTCCCTGGCAATGATCTCCAGG + Intronic
948211005 2:236193186-236193208 CCATCCTGCCGGTGTCCTCCGGG + Intergenic
1171125095 20:22595778-22595800 TCTTCCAAGTGATGTTCTCCAGG + Intergenic
1172312087 20:33926605-33926627 TCATCCTTGCGATGCTCTCACGG + Intergenic
1176256829 20:64157326-64157348 TCAGCCTGGCCAGGTTCCCCTGG + Intronic
1178042256 21:28652316-28652338 TCATCCTGGTGTTGGTTTCCTGG - Intergenic
1179435726 21:41360852-41360874 TGATCCTGACGATGATCTCCTGG + Intergenic
1180264231 21:46699365-46699387 CCGCCCTGGCGATGCTCTCCGGG - Intergenic
1182443265 22:30376329-30376351 TCACCCTGGGGATGTGCTCTTGG - Exonic
1185430392 22:50807311-50807333 CCGCCCTGGCGATGCTCTCCGGG - Intergenic
949222544 3:1653129-1653151 TTAGGCTGGGGATGTTCTCCTGG + Intergenic
950258196 3:11523136-11523158 ACAACCTGGGGATGTTCTCAGGG - Intronic
952715949 3:36481264-36481286 TCATACTGGCGAGGCTCTGCAGG - Intronic
953366884 3:42352724-42352746 GCATCCTGGGGATGTGCCCCAGG - Intergenic
956514983 3:70036675-70036697 TCATCCTGGCTTTGTTCTATGGG - Intergenic
960702257 3:120450588-120450610 GCGTCCTGGGGATGCTCTCCCGG - Intronic
966682995 3:182663051-182663073 TCATCTCCGCCATGTTCTCCAGG - Intergenic
967008891 3:185412791-185412813 TCATCCTGGAGCTTTTGTCCTGG + Intronic
969533563 4:7742142-7742164 TCATCCTGGAGATGGGATCCAGG + Exonic
969997551 4:11328442-11328464 TCATCCTTGCCATGTTCTTTTGG - Intergenic
970389352 4:15592012-15592034 TCCTCCTGGCTTTGTTGTCCTGG + Intronic
973743788 4:53943828-53943850 TAATCCTGGCCAATTTCTCCTGG - Intronic
976339647 4:83932792-83932814 TCATCCTGGTGGTGTCCTCAGGG + Intergenic
976998859 4:91469604-91469626 TCAACCTAGGGAAGTTCTCCAGG - Intronic
980772556 4:137395659-137395681 TCATTCTTGCCATGGTCTCCTGG - Intergenic
985053225 4:186013558-186013580 TCATCCTGTAGATGTTCTGGAGG - Intergenic
985930296 5:3051758-3051780 TCATCATGGCTATGTGTTCCAGG - Intergenic
986770418 5:10967778-10967800 CCATCCAGGTGATGTACTCCAGG + Intergenic
992529201 5:77638965-77638987 TCTTCCCTGCGATTTTCTCCAGG + Exonic
996959378 5:129227573-129227595 CCATCCTTGAGATTTTCTCCAGG + Intergenic
999965732 5:156807445-156807467 TGATGCTGGGGATGTTCTCCTGG - Intergenic
1001708783 5:173761400-173761422 TCAGCCTGGGAATGTTCTCTTGG + Intergenic
1006739055 6:36294348-36294370 TCATCCTGGCGATGTTCTCCAGG - Exonic
1006965586 6:37981030-37981052 TGCTCCTTGCTATGTTCTCCTGG - Intronic
1009610723 6:65937595-65937617 TCTTCCTGGCCATGTCTTCCTGG - Intergenic
1010885514 6:81234203-81234225 TCCTCCTGGTGATGCTGTCCAGG + Intergenic
1016254630 6:142089060-142089082 TCATCCTGGCGCTGTCCAGCGGG + Intergenic
1019906127 7:4066572-4066594 TCCTGATGGTGATGTTCTCCCGG - Intronic
1025809134 7:64863136-64863158 TCATGCTGGCGCCGTTCTCCTGG - Intergenic
1026960160 7:74402857-74402879 TCCTCCTGGCCTTGTTCTCCTGG + Intronic
1027461890 7:78464501-78464523 TCATTCTGGGGGTTTTCTCCAGG + Intronic
1028952317 7:96650389-96650411 GCCTCCTGGGCATGTTCTCCAGG + Intronic
1030744723 7:113151369-113151391 TCTTCCTTGGGATGTTTTCCTGG - Intergenic
1035243237 7:157545768-157545790 TCATCCTGGTCATGGTCTCCGGG + Intronic
1035263809 7:157677749-157677771 TCATCCTGGCTAAATTCTGCAGG + Intronic
1037797093 8:22005174-22005196 TGATCCTGGCTCTTTTCTCCAGG + Exonic
1038061439 8:23918106-23918128 TCATTTTGGTGATTTTCTCCAGG - Intergenic
1048992667 8:139770439-139770461 TCATCTTAGTGAAGTTCTCCAGG + Intronic
1049872998 8:144995582-144995604 CCATCCCAGCGATGTTCTGCTGG - Intergenic
1051345849 9:16150681-16150703 TCATCCTGTTGATGGTTTCCAGG + Intergenic
1052675180 9:31613107-31613129 TCATACTGCCTATATTCTCCAGG - Intergenic
1052763590 9:32617996-32618018 TAATACTGGAGATGATCTCCAGG - Intergenic
1054966792 9:71037676-71037698 TCATCATGCCGATGTTCTGCAGG - Intronic
1060342744 9:122791340-122791362 GGATCCTGAAGATGTTCTCCTGG - Intergenic
1190871392 X:54427441-54427463 TCATCCTGGCCATATTCTATCGG - Intergenic
1192351572 X:70360687-70360709 TCGTCCTAGCCATGTGCTCCCGG + Intronic
1192849873 X:74943123-74943145 ACATGCTGGAGAGGTTCTCCTGG + Intergenic
1193043949 X:77032914-77032936 CCATGCTGGAGAGGTTCTCCTGG - Intergenic