ID: 1006739057

View in Genome Browser
Species Human (GRCh38)
Location 6:36294369-36294391
Sequence GACCCACGCATTGTTCCCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 66}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006739055_1006739057 -2 Left 1006739055 6:36294348-36294370 CCTGGAGAACATCGCCAGGATGA 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG 0: 1
1: 0
2: 1
3: 9
4: 66
1006739052_1006739057 7 Left 1006739052 6:36294339-36294361 CCAGTTCTCCCTGGAGAACATCG 0: 1
1: 0
2: 2
3: 9
4: 101
Right 1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG 0: 1
1: 0
2: 1
3: 9
4: 66
1006739054_1006739057 -1 Left 1006739054 6:36294347-36294369 CCCTGGAGAACATCGCCAGGATG 0: 1
1: 0
2: 1
3: 6
4: 131
Right 1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG 0: 1
1: 0
2: 1
3: 9
4: 66
1006739049_1006739057 28 Left 1006739049 6:36294318-36294340 CCGCATGTTCAACTGCTCCTTCC 0: 1
1: 0
2: 0
3: 30
4: 270
Right 1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG 0: 1
1: 0
2: 1
3: 9
4: 66
1006739051_1006739057 11 Left 1006739051 6:36294335-36294357 CCTTCCAGTTCTCCCTGGAGAAC 0: 1
1: 0
2: 2
3: 21
4: 235
Right 1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG 0: 1
1: 0
2: 1
3: 9
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006739057 Original CRISPR GACCCACGCATTGTTCCCCC CGG Exonic
900131242 1:1088225-1088247 GACCCCCGCATGCCTCCCCCAGG + Intronic
901746087 1:11374692-11374714 GACTGACTCATTGTCCCCCCGGG + Intergenic
902185668 1:14723408-14723430 GTCCCACTCATTGCTGCCCCGGG - Intronic
905204747 1:36336994-36337016 GACCTCCGCATAGCTCCCCCAGG + Intergenic
916651943 1:166840837-166840859 GCCCCAAGCACTGTTCCCGCTGG - Intronic
920970817 1:210742388-210742410 TACCCCAGCATTGTTCCCCTGGG - Intronic
921380333 1:214518031-214518053 TACCAACGCATTGTTCCTTCTGG - Intronic
922339392 1:224643477-224643499 GACCCACTCACTGTCCCACCAGG - Intronic
924829694 1:247579935-247579957 GACCTAAGCATTCTTCCCTCTGG - Intergenic
1071307970 10:84315873-84315895 GACCTCAGCATTCTTCCCCCAGG - Intergenic
1071823986 10:89306243-89306265 GACCCAGGCATAGTTTCCCCAGG - Exonic
1076413955 10:130271639-130271661 GACAGAAGCCTTGTTCCCCCAGG + Intergenic
1076943990 10:133631219-133631241 GAACCAGGGGTTGTTCCCCCTGG - Intergenic
1096799189 12:54098224-54098246 GCCCCAGGCATTATTTCCCCAGG + Intergenic
1104288493 12:127447121-127447143 TTCCTATGCATTGTTCCCCCAGG + Intergenic
1104349837 12:128035643-128035665 GACCCACTGAGGGTTCCCCCTGG - Intergenic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1108385664 13:49897070-49897092 GAGCCACCCATTTCTCCCCCAGG - Intergenic
1113941659 13:114021572-114021594 AGGCCACGCTTTGTTCCCCCAGG + Intronic
1117371505 14:55082639-55082661 GACCCACTCATTCTACTCCCAGG + Intergenic
1128450859 15:67805215-67805237 GACCCACGCAGGGTGTCCCCAGG + Intronic
1131803366 15:96095850-96095872 GATCTACTCATTGTTTCCCCAGG + Intergenic
1133275942 16:4638552-4638574 CACCCACGCATTGATCCCCCTGG - Intronic
1133332169 16:4981584-4981606 GAGCCAGGCACTGTCCCCCCGGG - Intronic
1145846217 17:28041588-28041610 GACCCACACCTTGTTGCCACTGG + Intergenic
1147544996 17:41394239-41394261 GACCCAGGCATTCTTACCCTTGG - Intronic
1148463786 17:47852342-47852364 CACCCACGCATTCTTCTGCCTGG + Intronic
1148471577 17:47896640-47896662 GACCCAGGCATAGTTCGCCCAGG - Intronic
1149409636 17:56392240-56392262 AACCCACGCATTGTTACGCAAGG + Intronic
1150550796 17:66208013-66208035 GACCCATGTATTGTTCCTACTGG - Intergenic
1157887168 18:51379909-51379931 GACCCAGTCAATGTTCCCACGGG - Intergenic
1161285195 19:3464836-3464858 GGCCCACGCTTTGATCCCCAAGG - Intronic
1161465643 19:4428848-4428870 GACCCACGCACGTTTCCACCCGG + Exonic
1167323103 19:48808159-48808181 GACCCACGCTCTGATCACCCCGG - Intronic
1168369363 19:55819255-55819277 GACCCACACACTGTAGCCCCTGG + Intronic
928442639 2:31304847-31304869 GACCCACGTATTCTACCCACAGG - Intergenic
931762563 2:65431141-65431163 GCCCCGAGCATTGTTCCCCTCGG + Intronic
948191291 2:236061327-236061349 GACCCAGCCATTCCTCCCCCAGG + Intronic
948692101 2:239712466-239712488 GACCCACTCATGGTTGCCTCTGG - Intergenic
1171781343 20:29421333-29421355 GAACCAGGGATTTTTCCCCCTGG - Intergenic
1171797233 20:29576122-29576144 GCCCCAGGCATTATTTCCCCGGG - Intergenic
1171851019 20:30308039-30308061 GCCCCAGGCATTATTTCCCCAGG + Intergenic
1172557757 20:35857204-35857226 GCCCCACCCATTTTTGCCCCAGG - Intronic
1173595868 20:44258129-44258151 GACCCAAGCATTGAGCACCCAGG + Intronic
1177633191 21:23752774-23752796 GACCCACGCATTCTTCCACTTGG + Intergenic
1181316714 22:21975267-21975289 GCCCCAGGCATTGTCACCCCTGG - Intronic
1182566236 22:31202135-31202157 GACCTAGGCATGGTTCCCACAGG - Intronic
950579367 3:13852506-13852528 GACCCACTCCTTGTTCCGACCGG - Intronic
951742646 3:25941384-25941406 CACCTACCCATTGTTCCCCAGGG - Intergenic
962917561 3:139918280-139918302 GACCCACAGATCTTTCCCCCAGG - Intergenic
963881260 3:150531652-150531674 AACCCAAGAATTGTTCCCCTAGG + Intergenic
966793325 3:183692618-183692640 GACCCAGGCAGTCTGCCCCCAGG - Intergenic
979356542 4:119712408-119712430 GCCCCACACACAGTTCCCCCTGG + Intergenic
985447344 4:190031676-190031698 GAACCAGGGGTTGTTCCCCCTGG - Intergenic
985936166 5:3100188-3100210 GGCACACTCGTTGTTCCCCCTGG - Intergenic
998712609 5:144843884-144843906 GATCCATGCATTCTTCCCACTGG + Intergenic
1001683034 5:173572703-173572725 GAGCCAGCCATTGCTCCCCCTGG - Intergenic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1008547010 6:52592002-52592024 GAGCCAAGCATGGTTACCCCAGG + Intergenic
1012367082 6:98454722-98454744 GCTACAAGCATTGTTCCCCCTGG - Intergenic
1020043502 7:5022196-5022218 GACCCACGCAGAGTCCCACCGGG - Intronic
1024537579 7:50450659-50450681 GAGCCACGCTTTGCTCTCCCAGG - Intronic
1029977910 7:104851539-104851561 GGCCAACGCATTGGTCACCCTGG + Intronic
1037639578 8:20730526-20730548 GACCCAGGCACTGTTCCCATTGG - Intergenic
1047349528 8:124060430-124060452 GAACCACGCTGTGTTCCTCCAGG - Intronic
1048476606 8:134748139-134748161 GACCCAAGCAATCATCCCCCAGG + Intergenic
1049582686 8:143420056-143420078 GAGCCAAGCTCTGTTCCCCCAGG + Intronic
1049763936 8:144344182-144344204 GCCCCAGGAATTGTTCCTCCGGG + Intergenic
1052337430 9:27334847-27334869 GAGTCTCGCTTTGTTCCCCCAGG + Intronic
1053788793 9:41671320-41671342 GACCCAGGCATTATTTCCCCAGG + Intergenic
1054156347 9:61643448-61643470 GACCCAGGCATTATTTCCCCAGG - Intergenic
1054177074 9:61882659-61882681 GACCCAGGCATTATTTCCCCAGG + Intergenic
1054476119 9:65574458-65574480 GACCCAGGCATTATTTCCCCAGG - Intergenic
1054660460 9:67698147-67698169 GACCCAGGCATTATTTCCCCAGG - Intergenic
1057885639 9:98827628-98827650 GCCCTAGGCATTGTTCCTCCTGG - Intronic
1185593678 X:1294549-1294571 CACCCACGCATCCTTCCCCCAGG - Intronic
1195477148 X:105300191-105300213 GTCTCACGTATTTTTCCCCCAGG - Intronic