ID: 1006740816

View in Genome Browser
Species Human (GRCh38)
Location 6:36307148-36307170
Sequence CTGCAGGTATTGAGAGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006740804_1006740816 30 Left 1006740804 6:36307095-36307117 CCTCCCTGCCTTGGGACCACTCT 0: 1
1: 0
2: 2
3: 42
4: 337
Right 1006740816 6:36307148-36307170 CTGCAGGTATTGAGAGAGCAGGG No data
1006740808_1006740816 22 Left 1006740808 6:36307103-36307125 CCTTGGGACCACTCTGGCAGTAG 0: 1
1: 0
2: 1
3: 12
4: 106
Right 1006740816 6:36307148-36307170 CTGCAGGTATTGAGAGAGCAGGG No data
1006740806_1006740816 27 Left 1006740806 6:36307098-36307120 CCCTGCCTTGGGACCACTCTGGC 0: 1
1: 0
2: 0
3: 16
4: 198
Right 1006740816 6:36307148-36307170 CTGCAGGTATTGAGAGAGCAGGG No data
1006740807_1006740816 26 Left 1006740807 6:36307099-36307121 CCTGCCTTGGGACCACTCTGGCA 0: 1
1: 0
2: 1
3: 14
4: 170
Right 1006740816 6:36307148-36307170 CTGCAGGTATTGAGAGAGCAGGG No data
1006740811_1006740816 14 Left 1006740811 6:36307111-36307133 CCACTCTGGCAGTAGCTGGGTTT 0: 1
1: 0
2: 1
3: 16
4: 196
Right 1006740816 6:36307148-36307170 CTGCAGGTATTGAGAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006740816 Original CRISPR CTGCAGGTATTGAGAGAGCA GGG Intronic
No off target data available for this crispr