ID: 1006743766

View in Genome Browser
Species Human (GRCh38)
Location 6:36326948-36326970
Sequence CTGCAAGGACAGGTGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 299}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006743766 Original CRISPR CTGCAAGGACAGGTGGAGCT TGG Intronic
900108214 1:994878-994900 GGGTAGGGACAGGTGGAGCTGGG - Intergenic
900203248 1:1420553-1420575 CAGCACGGCCAGGTGGAGCGGGG + Exonic
900288029 1:1911077-1911099 CTACCAGGGCAGGTGGGGCTCGG + Intergenic
902777288 1:18682919-18682941 GTGCAGGGACAGGTGGAGAAGGG - Intronic
903547693 1:24136996-24137018 CTGCAAGGGGAGGGGCAGCTGGG - Intronic
903778846 1:25809234-25809256 GTGGGAGGAGAGGTGGAGCTGGG - Intronic
904591355 1:31617349-31617371 CAGCAAGGAGAGGCGGGGCTGGG + Intergenic
905800191 1:40838161-40838183 CCGCCTGGAAAGGTGGAGCTTGG - Intronic
907306701 1:53517331-53517353 CTGGACAGACAGGTGGTGCTAGG - Intronic
909803687 1:79847830-79847852 CTGCAGGGACGGCTGCAGCTGGG - Intergenic
910712254 1:90194019-90194041 CTCCAAGGCTAGGTGAAGCTAGG + Intergenic
912567372 1:110597940-110597962 CAGCAGGGACAGATGGAGGTAGG - Intronic
915009930 1:152676123-152676145 CTGCAGGGAAACATGGAGCTGGG - Exonic
915973907 1:160372562-160372584 GTGTCAGGACAGGTGGATCTGGG - Exonic
917763717 1:178194460-178194482 CTGGAAGTACAGGAGAAGCTTGG + Intronic
917968836 1:180194706-180194728 CTGCTAGGGCAGAGGGAGCTGGG + Intronic
919083293 1:192891621-192891643 CAGCAAAGACAGGGGGAGCCTGG - Intergenic
919133522 1:193480402-193480424 CTGCAAGGAGTGGGGGAGATAGG + Intergenic
920200572 1:204257527-204257549 CTGCAGGGACAGGCGGCGCAGGG + Exonic
920350665 1:205335924-205335946 CTTCAAGGACAAGTGGAACCTGG - Intergenic
920878115 1:209855987-209856009 CCGCAAGGAGAGGTGGCCCTGGG + Exonic
922754935 1:228090436-228090458 CTGCAGGGAGAGGTGGGGGTAGG + Intronic
923006321 1:230052886-230052908 ACACAAGGACAGGTGGAGCAGGG - Intergenic
923640493 1:235754518-235754540 CTGAAAAGACAGGTGAGGCTGGG - Intronic
1063615105 10:7593847-7593869 CTGCAAGGATTGGTGGGGCCAGG - Intronic
1064245619 10:13665711-13665733 CTGGAAGGACAGGTGGGGCTGGG - Intronic
1064438812 10:15334486-15334508 CTGCAAGCACATGTTGAGTTGGG - Intronic
1067371407 10:45686769-45686791 ATGGAAGGACAGGTGGACTTGGG + Intergenic
1067388377 10:45839380-45839402 ATGGAAGGACAGGTGGACTTGGG - Intronic
1067417692 10:46117577-46117599 ATGGAAGGACAGGTGGACTTGGG + Intergenic
1067445890 10:46345198-46345220 ATGGAAGGACAGGTGGACTTTGG + Intergenic
1067503104 10:46824465-46824487 ATGGAAGGACAGGTGGACTTGGG + Intergenic
1067874878 10:49996683-49996705 ATGGAAGGACAGGTGGACTTGGG + Intronic
1069989991 10:72309321-72309343 CTGCAAGGGCATCTGGACCTGGG - Intergenic
1070167711 10:73911164-73911186 CTGCGGGGACAGGTGGACCCTGG - Exonic
1071851339 10:89573461-89573483 CTGGATGGAGAGGTAGAGCTTGG - Intergenic
1074928038 10:118093565-118093587 CTGGAAGGGAACGTGGAGCTGGG + Intergenic
1076755751 10:132570805-132570827 CTGCCAGGACAGCAGGAGGTGGG + Intronic
1079665445 11:23099579-23099601 CTGTGAGGAAAAGTGGAGCTTGG - Intergenic
1081716839 11:45256464-45256486 ATGCAAAAACAGGTGGAGGTAGG - Intronic
1083260258 11:61518714-61518736 CTTCCAGGACAGGTAGATCTGGG + Exonic
1083840158 11:65299630-65299652 CAGCAAGGCCAGGTTGAGCTGGG - Intronic
1084429815 11:69104923-69104945 CTGGCAGCACAGGTGAAGCTGGG + Intergenic
1084576062 11:69988734-69988756 CCACAAGGGCAGGTGGAGTTAGG + Intergenic
1084709345 11:70834410-70834432 CTGCAAGATAAAGTGGAGCTTGG - Intronic
1085054926 11:73397940-73397962 CTGCAAGGCCAGGTGCTGCTGGG + Intergenic
1085695954 11:78704960-78704982 CTGCAGGGACAGAGGGAGCTGGG - Intronic
1086042602 11:82496882-82496904 CAGCAAGGACAGGAAGAGCATGG - Intergenic
1088936228 11:114402893-114402915 CTGCTAGGAGATGTGGAGGTAGG - Exonic
1089277010 11:117344143-117344165 CTGCAAGGAGAGGCAGAGGTGGG - Intronic
1094133227 12:27097429-27097451 TTTGAAGTACAGGTGGAGCTGGG - Intergenic
1094255222 12:28416502-28416524 CGGCAAGGACAGGTGGGAGTGGG + Intronic
1094331839 12:29302449-29302471 CTGGCAGGGCAGCTGGAGCTGGG + Intronic
1096814761 12:54195011-54195033 TTTCAAGGACATTTGGAGCTGGG + Intergenic
1098893668 12:76033378-76033400 CTCCAAGGGCAGGTGTAGTTGGG + Exonic
1101398533 12:104368814-104368836 CTGGAAGCCCAGGTGGGGCTTGG - Intergenic
1104081002 12:125430539-125430561 CTCCCAGGGAAGGTGGAGCTGGG + Intronic
1104861952 12:131928759-131928781 CTGCGAGGACCGCTGGAGCCCGG + Intergenic
1104926142 12:132314873-132314895 CTGGAAGGTCGGGTGGACCTCGG + Intronic
1105532138 13:21229833-21229855 CTGTGAGGGCAGGTGCAGCTGGG + Intergenic
1105582114 13:21707999-21708021 CTAAAAGGACTGATGGAGCTTGG + Intergenic
1107126427 13:36851348-36851370 CTGGAAGGAGACATGGAGCTAGG - Intronic
1109326105 13:60869809-60869831 GTGCAAGGACAGCTGCTGCTGGG + Intergenic
1112662217 13:101523145-101523167 TTTCAAGGACAAATGGAGCTAGG - Intronic
1112921036 13:104613055-104613077 CAGCAAGTACAGGTGAAACTGGG + Intergenic
1114574864 14:23703025-23703047 CAGCAAGGACAGTTGGAGGAAGG + Intergenic
1116735900 14:48691214-48691236 CTGTAAGGGCTGTTGGAGCTGGG - Intergenic
1121098503 14:91234004-91234026 CTGGAAGGCCGGGTGGAGCTTGG + Exonic
1121518667 14:94570687-94570709 CTGAAAGCACAGGGTGAGCTAGG - Intronic
1122415277 14:101546649-101546671 CTCGAAGGACAGGTAGGGCTTGG + Intergenic
1122710568 14:103654041-103654063 CATCAAGGACAGGTGCAGCACGG - Intronic
1122837492 14:104437303-104437325 CTTCCAGGGCAGGTGGGGCTGGG - Intergenic
1122886357 14:104712146-104712168 CTTCCAGGGCAGGTGGAGCCCGG - Intronic
1123120407 14:105913787-105913809 TTCCCAGGACAGCTGGAGCTGGG - Intergenic
1125780092 15:42257520-42257542 ATGAAAGGACACCTGGAGCTGGG - Intronic
1128566274 15:68702202-68702224 CAGCTAGGAAAGGAGGAGCTGGG - Intronic
1129706669 15:77798378-77798400 CTGCCAGCTCAGGTGGAGCTGGG - Intronic
1130032349 15:80327517-80327539 CTGCCAGGGCAGGTGGGGATGGG + Intergenic
1130270711 15:82445530-82445552 CAGCAGGGAGAGGCGGAGCTGGG + Intergenic
1130559943 15:84950134-84950156 CTGCAAGGAAAGGCAGCGCTTGG + Intergenic
1130566227 15:84998231-84998253 CTGCAAGTATTGGTGAAGCTGGG + Intronic
1131272797 15:90957162-90957184 CTGCAAGGACGCGTGGGCCTCGG + Exonic
1131434668 15:92413399-92413421 CTGCGAGTTAAGGTGGAGCTAGG + Intronic
1132142499 15:99407272-99407294 CTGCAAAGCCAGGTGCAGCAGGG + Intergenic
1132636938 16:954547-954569 CTTCCAGGACAGGACGAGCTGGG - Exonic
1133255993 16:4516471-4516493 CAGCAGGGACATGTGGAGATGGG - Intronic
1133335317 16:5003363-5003385 CAGCAGAGCCAGGTGGAGCTGGG + Intronic
1133563925 16:6974989-6975011 CTGGAAGAAAGGGTGGAGCTAGG + Intronic
1136114643 16:28087175-28087197 CTGGAAGGGCAGCAGGAGCTGGG + Intergenic
1137720371 16:50624153-50624175 GTGGAAGGAGAGGTGGAGTTTGG + Intronic
1137841912 16:51648822-51648844 CAGCAAGTAAAGGAGGAGCTTGG - Intergenic
1138281649 16:55776502-55776524 ATGAAAGGCAAGGTGGAGCTGGG - Intergenic
1138449231 16:57083245-57083267 TTCCAAGGACAGGTGGAGGTAGG + Exonic
1138543884 16:57705165-57705187 CTGCAGGGCCAGGTAGAGGTTGG - Intronic
1138597265 16:58035686-58035708 CTCTGGGGACAGGTGGAGCTAGG - Intronic
1139611114 16:68059462-68059484 GTGGAAGGACAGATGGAGCCAGG + Intronic
1140457453 16:75113519-75113541 CTGCAAGGTGAGCTGGGGCTGGG - Exonic
1141521607 16:84583834-84583856 CTCCAAGGAGAAGTGGAGGTGGG - Intronic
1141841751 16:86578135-86578157 CAGGAAGGAGAGGTGGAGATGGG - Intronic
1142065346 16:88059230-88059252 CTGTAAGGGCAGGTGGGGGTGGG + Intronic
1142108960 16:88321135-88321157 CAGCCTGGACAGGAGGAGCTTGG - Intergenic
1142267714 16:89072182-89072204 CTACAAGGACAGGAGGTGCTGGG + Intergenic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1143572818 17:7771171-7771193 CTACAAGGAAAGCTGGAGGTAGG - Intronic
1144731591 17:17529242-17529264 CTGGCAGGACAGGTGGAACTGGG - Intronic
1146515177 17:33483489-33483511 CTGCACTGGCAGGTGGAGCGAGG + Intronic
1147863591 17:43538484-43538506 ATGCCAGGATGGGTGGAGCTGGG + Intronic
1148649130 17:49237103-49237125 CAGGAAGTACAGGAGGAGCTGGG + Intergenic
1148975917 17:51528123-51528145 CTGCAAGGAGAGGTGGGGGGCGG - Intergenic
1150069415 17:62138936-62138958 CTGCCAGTGCAGATGGAGCTGGG - Intergenic
1150128333 17:62652954-62652976 CTCCAAGAGCAGGTGGATCTGGG + Intronic
1150621306 17:66809664-66809686 CTGCAAGTTCAGGTGGAACTTGG + Exonic
1151125197 17:71837303-71837325 CTCCAAGGACATGTGGAAATGGG - Intergenic
1151463353 17:74268846-74268868 CTGCTAGGAACGGTGGAGATGGG - Intergenic
1151517046 17:74603279-74603301 GTGGAAGGAAAGGAGGAGCTGGG + Intergenic
1151589523 17:75034235-75034257 CTGCCCCGCCAGGTGGAGCTGGG - Intronic
1151986735 17:77548571-77548593 CGGCCAGGAGAGGAGGAGCTGGG - Intergenic
1152198867 17:78933764-78933786 CTGCAAGGACAGTTTGAGCAGGG + Intergenic
1153925454 18:9831666-9831688 CTGTAGGGCCAGGTGGAGCCTGG + Intronic
1154274076 18:12944853-12944875 CTGCTAGTACTGCTGGAGCTAGG - Intergenic
1156498191 18:37540020-37540042 CTGCAAGGCTAGGTGGAGACAGG - Intronic
1157895685 18:51464650-51464672 CTGGGAGGACAGCAGGAGCTTGG + Intergenic
1158545028 18:58388911-58388933 CTGCTATGGCAGGTGGAGCCTGG + Intronic
1160333761 18:78018486-78018508 CTGCAAGGCCAGGCAGAGCCCGG + Intergenic
1160727112 19:622273-622295 CTGCCAGTGCAGATGGAGCTGGG - Exonic
1160781332 19:879011-879033 CTGCTGGGACATGTGGGGCTGGG - Intronic
1161018759 19:1997658-1997680 CGGCAAGGACAGGCAGGGCTAGG + Intronic
1161064951 19:2233004-2233026 CAGCCAGGACAGGTGGAGGCTGG - Intronic
1161550183 19:4908563-4908585 CTCCAAGGACAGATGGGTCTAGG - Intronic
1161793923 19:6375799-6375821 CTGCAGGGACAGGAGCAGCAGGG + Exonic
1162127447 19:8507042-8507064 CTGCAGGGAGAGGAGGGGCTTGG - Intergenic
1162828139 19:13266947-13266969 CTGCAAGAACTGGTGGGGCATGG + Intronic
1163238555 19:16043990-16044012 TGGCAAGGACAAGTGGAGCCAGG + Intergenic
1163850754 19:19662064-19662086 CAGCCAGGAGAGGTGGATCTGGG - Intronic
1164877637 19:31702790-31702812 CTGGAATGACTGGAGGAGCTAGG + Intergenic
1164958476 19:32406235-32406257 CTCCAAGGACAGGGGCAGCCGGG - Exonic
1165800634 19:38547435-38547457 CAGCAAGGAGAGGTAGAGATTGG - Intronic
1165895022 19:39136300-39136322 CTGCTGGGAGAGGTGGAGCCAGG - Intronic
1166046142 19:40232236-40232258 CGGCTAGTACAGGAGGAGCTGGG + Exonic
1166299261 19:41904926-41904948 CTGCAGGGAGAGGGGGAGATGGG - Intronic
1166382389 19:42361866-42361888 CTGCATGGGCAGGAGGACCTGGG + Intronic
1167040125 19:47019120-47019142 CTGCATGGAGAGAAGGAGCTAGG + Intergenic
925556654 2:5138176-5138198 ATGTAAGCACAGGTGGTGCTTGG - Intergenic
925615345 2:5740016-5740038 GTGCCAGGAAGGGTGGAGCTTGG - Intergenic
927215955 2:20667863-20667885 CTGCAAGGCCAGGGAGACCTGGG - Intronic
927489966 2:23514796-23514818 CAGCAAGGATAGATGGAGCGTGG - Intronic
927927288 2:27022896-27022918 CTGCAGGGAAAGGAGGAGCGGGG + Intronic
929138937 2:38650557-38650579 CTGCAAGGCCAGGGAGGGCTGGG - Intergenic
929793173 2:45038580-45038602 CAGCAGGGAAAGGTGGATCTGGG + Intergenic
929921100 2:46172178-46172200 CTGCAAAGCCAGGCTGAGCTGGG + Intronic
931097150 2:58954014-58954036 CTGGAAGGACAGGTGAAGATGGG - Intergenic
931424091 2:62155018-62155040 ATGCAATGAGAGGTGGAGATTGG - Intergenic
931699976 2:64901605-64901627 CTGCCAGGAGAGCTGGAGGTGGG - Intergenic
932064781 2:68543170-68543192 CGGGGAGGACAGGAGGAGCTGGG + Intronic
933687876 2:85157787-85157809 CTGCAAGGACCAGGGGAGCTGGG + Intronic
933691079 2:85180073-85180095 CTGCAAGGACTGTTGGAGAAAGG + Intronic
933699342 2:85243588-85243610 CAGCAAGGGAAGGGGGAGCTGGG + Intronic
935059002 2:99592215-99592237 AAGCAAGGACAGGGAGAGCTGGG - Intronic
935662064 2:105475408-105475430 CTTGAATGACAGGTGGAGCTAGG + Intergenic
936523422 2:113226848-113226870 CTGGAAGAAGTGGTGGAGCTTGG + Intronic
937241846 2:120466875-120466897 CTGGAGGGACAGGCAGAGCTGGG + Intergenic
937264316 2:120606547-120606569 CGGCCAGGAGAGGTGGAGCCTGG + Intergenic
937470539 2:122170404-122170426 CTGCAAGGACTGGTTGAGGGAGG + Intergenic
937980573 2:127612258-127612280 CTGCAAGGACAAGGGGACCAAGG + Intronic
938563083 2:132491778-132491800 CAGCAAGGACATGTGAAGCTAGG - Intronic
941244893 2:163084607-163084629 CTACAAGGACATGTAGAACTAGG + Intergenic
941542464 2:166803903-166803925 CTACAAGGAGATCTGGAGCTGGG - Intergenic
944778080 2:202989447-202989469 TTGAAAGTGCAGGTGGAGCTGGG - Intronic
945172852 2:207014923-207014945 CTTCAGGGACAGGTGGACCTAGG - Intergenic
945247305 2:207730223-207730245 ATGGGAGGACAGGTGGACCTGGG + Intronic
948802887 2:240440810-240440832 CGGCACGGCCAGGAGGAGCTGGG - Intronic
1169389709 20:5179677-5179699 CTGCAACCTCAGGGGGAGCTAGG + Intronic
1170706035 20:18745551-18745573 CTGGAAGGACAGGTGGCAGTGGG + Intronic
1171092196 20:22295916-22295938 CAGCTAGCAGAGGTGGAGCTGGG + Intergenic
1171186965 20:23129656-23129678 CTGGAAGGAATGGTGGAGTTTGG + Intergenic
1171274367 20:23843069-23843091 CTGCAAAGAGAGGTGCAGGTAGG + Intergenic
1171462131 20:25304116-25304138 CTGCCAGGACCGGCGGAGCCTGG + Intronic
1172484055 20:35287955-35287977 CTGCAAAGCCAGGTGAAGCTGGG + Exonic
1173020941 20:39267886-39267908 CTGCAAGGGCAGGTGGAATAAGG + Intergenic
1173176850 20:40771250-40771272 CTGCAGGGACAGGAGGCACTTGG - Intergenic
1174447055 20:50597502-50597524 CTGGCAGGAAACGTGGAGCTCGG + Intronic
1175345750 20:58273458-58273480 CAGCAAGGGAAGGAGGAGCTGGG + Intergenic
1175774968 20:61647336-61647358 CTGCTAGGACAAGTTGCGCTAGG - Intronic
1176021043 20:62962601-62962623 CTGCAAAGACAGGGGGAGTGTGG - Intronic
1176111073 20:63411023-63411045 CTGCCAGCTCACGTGGAGCTGGG + Intronic
1177007081 21:15686772-15686794 CAGAATGGACATGTGGAGCTGGG - Intergenic
1177688951 21:24478167-24478189 CTGCAATGCCAGATGGTGCTTGG - Intergenic
1178409354 21:32350770-32350792 CTGCATGGACAGGTGTGGCATGG + Exonic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1179195580 21:39159843-39159865 GTCCATGGGCAGGTGGAGCTTGG - Intergenic
1179867348 21:44225415-44225437 CTGCATGGACAGCTGCAGCCTGG + Intronic
1180581972 22:16846179-16846201 CCACAGGGACAGGGGGAGCTTGG - Intergenic
1181161140 22:20960639-20960661 CTGGAGGAACAGGGGGAGCTGGG - Intergenic
1181318198 22:21984847-21984869 CTGGAGGGAGAGGAGGAGCTCGG - Intergenic
1182269430 22:29144294-29144316 CTGCAGGGAGAGGTGGCACTCGG + Intronic
1183698734 22:39437931-39437953 CTGCCAGCACAGGAGGAGCCTGG - Intergenic
1184556466 22:45235905-45235927 TTGCTAGGCCAGGTGTAGCTGGG - Intronic
1184770517 22:46594331-46594353 GTGGAAGGACAGGTGGAAGTGGG + Intronic
1184798614 22:46746786-46746808 CAGCGAGCGCAGGTGGAGCTGGG - Intergenic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
952892280 3:38051355-38051377 CAGCAGGGACAGGTGGGGTTGGG - Intronic
953457787 3:43056315-43056337 CAGCGAGGACAGGTGCTGCTGGG + Exonic
953886555 3:46717541-46717563 CTGGAAGGACAGGTGGCCTTGGG + Exonic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
954872962 3:53781497-53781519 GTGCAAGCAGAGGAGGAGCTGGG + Intronic
956323056 3:68020286-68020308 CTGCAGGGACAGGGGAAACTTGG + Intronic
957814275 3:85272856-85272878 CTGCAATGAAAGGTGAAGCAGGG - Intronic
960169352 3:114440325-114440347 CTGTAAGGAAGGGTGGAGCTGGG + Intronic
960635738 3:119782647-119782669 CTCCAAGGACTGTGGGAGCTGGG + Intronic
961785582 3:129344740-129344762 CTGCAAGGACAGGGGCTCCTGGG + Intergenic
962196222 3:133365840-133365862 CTCCAAGGTCTGGTGAAGCTAGG + Intronic
962535838 3:136328079-136328101 CTGGAAGCTGAGGTGGAGCTGGG - Intronic
963969734 3:151416349-151416371 CTGCGAGGACTGCTGGGGCTGGG - Exonic
964077537 3:152709831-152709853 CAGCAGGGAAAGGTGGAGCTGGG - Intergenic
965107792 3:164380323-164380345 CTGGAAGGACAGGTCCTGCTGGG - Intergenic
966080117 3:175989900-175989922 CTGCTAGGCCAGGGAGAGCTAGG - Intergenic
967655292 3:192041281-192041303 ATGCAAGGACAGGCTGGGCTCGG + Intergenic
967775839 3:193385028-193385050 CTACAAAGACCGGAGGAGCTAGG + Intergenic
968479804 4:828056-828078 CTCCAAGCACACCTGGAGCTGGG + Intergenic
969101011 4:4768318-4768340 CATCAAGGAAGGGTGGAGCTGGG + Intergenic
970361647 4:15314977-15314999 TTTCAAGGGCAGTTGGAGCTGGG - Intergenic
970828623 4:20308122-20308144 CTTCATGGAGAGGTGTAGCTTGG + Intronic
973267344 4:48224124-48224146 CTGAATGTACAGGTGGAGTTGGG + Intronic
973742867 4:53935199-53935221 CTGCAAAGAAAGGAGGAGTTGGG - Intronic
977806641 4:101307271-101307293 CTGTAATCACAAGTGGAGCTAGG - Intronic
979389571 4:120112238-120112260 CTGTAAGGACAGGGGAAGCAAGG + Intergenic
980423896 4:132600035-132600057 CTGCTGGGACAGATGGAGGTTGG - Intergenic
982127804 4:152199526-152199548 CTGCTAGTAAGGGTGGAGCTGGG - Intergenic
983369464 4:166840425-166840447 GGGCAAGGACAGGTAAAGCTAGG - Intronic
983760543 4:171400900-171400922 CTACAAGGACATATGAAGCTAGG + Intergenic
985564019 5:606345-606367 CAGGAAGGACTGGTGGGGCTGGG - Intergenic
985629376 5:1006814-1006836 CTGGGAGGACAGGTGGAGGTGGG - Intergenic
986118084 5:4800485-4800507 CTGTGAAGGCAGGTGGAGCTGGG + Intergenic
986317589 5:6600918-6600940 CTGGCTGGACAGGTGGAGCCTGG - Intronic
990269458 5:54119859-54119881 CTGCAAGATCAGGTAAAGCTTGG - Intronic
990997910 5:61751571-61751593 CTTCAAGGATCTGTGGAGCTGGG - Intronic
991958020 5:72015047-72015069 AGGCAAAGACAGGAGGAGCTAGG - Intergenic
992501710 5:77350008-77350030 CTGGAGGAACAGGTGCAGCTGGG - Intronic
995323603 5:110865600-110865622 ATGGAAGGACCTGTGGAGCTGGG + Intergenic
995727216 5:115193883-115193905 CTGCTGGGGCAGGTGAAGCTTGG + Intergenic
997200219 5:132005514-132005536 CAGCAAGGACAGTTAGAGCTGGG - Intronic
997912287 5:137888209-137888231 CTGCTGGGAGAGGTTGAGCTGGG + Intronic
998014704 5:138722949-138722971 CTGCAAGGACTGCTGGGGGTGGG - Intronic
998104145 5:139457605-139457627 CTGCAAGGACAGAGGCAGATAGG + Intronic
999273213 5:150310333-150310355 CAGCTAGGAAGGGTGGAGCTGGG - Intronic
1000300010 5:159947935-159947957 ATCCAGGGACAGCTGGAGCTTGG - Intronic
1001100286 5:168808728-168808750 CTGCAAAGAGAGGTGGAGCAGGG - Intronic
1001949371 5:175805646-175805668 CTGGAAGGAAAGGTGGGGCTGGG - Intronic
1002362346 5:178682484-178682506 CTGAAAAGACAAGTGCAGCTGGG + Intergenic
1002701897 5:181130458-181130480 CTGGCAGGAGAGGTGGAGCCAGG + Intergenic
1002703900 5:181147688-181147710 CTGGCAGGAGAGGTGGAGCCAGG - Intergenic
1002826756 6:781188-781210 CTACGAGGACAGGTGGCACTTGG + Intergenic
1002939702 6:1705343-1705365 CTGCCAGGACAGGCTGAGTTAGG + Intronic
1002939799 6:1705935-1705957 TTGCAAGAACAGGTGCATCTGGG + Intronic
1003371208 6:5528616-5528638 ATGTAAGGACAAGTGGTGCTAGG - Intronic
1003390557 6:5709328-5709350 CTGTGAGGGCAGGTGCAGCTGGG - Intronic
1003733118 6:8848406-8848428 CTCCAAAAACAGGTGGATCTTGG - Intergenic
1004011511 6:11692863-11692885 CTGCAAGGAGAGGCAGAGCAAGG + Intergenic
1006014519 6:31069160-31069182 GTGCAAGGAAAGGGGGAGGTGGG - Intergenic
1006743766 6:36326948-36326970 CTGCAAGGACAGGTGGAGCTTGG + Intronic
1007762127 6:44139346-44139368 CTGCCAGATCAGCTGGAGCTAGG + Intronic
1007762165 6:44139502-44139524 CTGAAAGGACAGGTAGTGCACGG - Exonic
1007821364 6:44562800-44562822 CTGCAAGTCCAGGTGGAGAATGG - Intergenic
1008452195 6:51665923-51665945 GTGTAAGCACAGGTGGAGGTGGG + Intronic
1010738337 6:79468543-79468565 CTAACAGGACAAGTGGAGCTGGG - Intergenic
1011768690 6:90652224-90652246 CAGCAAGGTCAGGTTGAGCCAGG - Intergenic
1014530552 6:122553895-122553917 CTGTCAGGCCAGCTGGAGCTTGG + Intronic
1015567515 6:134588709-134588731 GTGCAAAGAAAGGTAGAGCTGGG - Intergenic
1015969252 6:138727910-138727932 TTTCAATGACAGGTGGGGCTAGG + Intergenic
1017200077 6:151743233-151743255 CTGCAAGGGCATGTAGGGCTTGG + Intronic
1017503971 6:155050621-155050643 CTGCAAGGAAATGAGAAGCTAGG - Intronic
1019436779 7:1026277-1026299 CAGCAATGCCAGGTGCAGCTGGG - Intronic
1019523161 7:1469506-1469528 CTGCAAGCCCAGGTGGCGCGAGG - Intergenic
1019542096 7:1556103-1556125 CTGCCAGCAAAGGTAGAGCTGGG - Exonic
1019618516 7:1978139-1978161 CTGCAGTGAGAGGGGGAGCTGGG - Intronic
1019635994 7:2076009-2076031 AGGCCAGGACAGGTGGTGCTGGG + Intronic
1023660082 7:42462152-42462174 CTGCAAGGACAGGAAGCCCTGGG - Intergenic
1023964388 7:44955134-44955156 CTGCAAGGACAGGCTGAGTGTGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1027738511 7:81967971-81967993 CTGCAAGCACTGGTGGGGTTAGG - Intronic
1028243900 7:88452911-88452933 CTGCAGGGAGAGTTGGTGCTGGG + Intergenic
1030469018 7:109939400-109939422 CTGTGATGACAGGTGCAGCTTGG + Intergenic
1031008280 7:116499047-116499069 CTGCAAGTGCATGTGGAGTTGGG - Intronic
1031922095 7:127609500-127609522 CTGCAAGGACAGCGGGAACCCGG - Intergenic
1034119602 7:148615581-148615603 CTGCAGGTACACGTGGAACTTGG - Exonic
1034367147 7:150560859-150560881 AAGCAAGGACAGGTGTGGCTGGG + Intergenic
1035713756 8:1738441-1738463 CAGCCAGGACAGGTGGAGAACGG + Intergenic
1036068696 8:5415228-5415250 CTGTGAGCACAGGAGGAGCTGGG + Intergenic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1037832436 8:22197442-22197464 CTCCGAGGAGAGGTGGGGCTAGG - Intronic
1038270038 8:26067636-26067658 CTTCAAGGAGTGCTGGAGCTGGG + Intergenic
1041007684 8:53511145-53511167 CTGTAAGGACATGGGGATCTGGG - Intergenic
1043166491 8:76909221-76909243 CTGCAAGGACAGCTAAACCTGGG + Intergenic
1044941441 8:97347993-97348015 CTGCAGGGTCAGGTAGACCTAGG + Intergenic
1044974532 8:97650583-97650605 CTTGAAGGACAGGTGGAAATTGG - Intronic
1047897509 8:129383034-129383056 CTACCAGGAGAGTTGGAGCTGGG + Intergenic
1049158046 8:141078866-141078888 CTGTGAGGACGGCTGGAGCTGGG - Intergenic
1049270898 8:141695710-141695732 CTGGGACGACTGGTGGAGCTGGG + Intergenic
1049339287 8:142103377-142103399 GTGCAGGCACAGGTGGACCTAGG - Intergenic
1051042237 9:12825594-12825616 CTGCAGGGGCAGGTGGACATGGG - Intergenic
1052812721 9:33075820-33075842 TGGCAAGGACAGGTGGAGGATGG + Intronic
1054769148 9:69068218-69068240 CTGTAGGGCCAGGTGGAGCCTGG + Intronic
1055167491 9:73214755-73214777 CTGCAAGATCAGGTAGAGCCAGG + Intergenic
1055641051 9:78319356-78319378 CTGCAAGCCCAGGGGGAGTTAGG + Intronic
1056946853 9:91005026-91005048 CTGCAGGGATAGGTGGAGCTCGG - Intergenic
1057149218 9:92781462-92781484 ATGCAAAGACAGGTGGTGATGGG - Intergenic
1057227959 9:93302378-93302400 CTGCAAGTAGAGGAGGAGCAGGG + Intronic
1057631276 9:96720746-96720768 CTGCCAGTGCAGGAGGAGCTAGG - Intergenic
1060342923 9:122792792-122792814 CTCCAAGAAGAGGTGGAGCATGG + Intergenic
1060359369 9:122940847-122940869 CTGAAAGCCCAGGTGGGGCTCGG + Intronic
1060787319 9:126460772-126460794 CTGCCAGCAGAGGTGGAGCCAGG - Intronic
1061060997 9:128250532-128250554 CTGCAAGGCTGGGTGGAGCTGGG + Intronic
1061140635 9:128764102-128764124 CTGCAAGGAGAGGGGGTGCATGG + Intronic
1062364904 9:136203885-136203907 CTGCAAGGACAGGTGGGTTCTGG - Intronic
1189974018 X:46444766-46444788 CATCTAGGACAGGTGGTGCTTGG + Intergenic
1192890049 X:75380759-75380781 CAGCAAGGGCAGGTGTAGTTGGG - Intronic
1193508671 X:82372862-82372884 CTGCAATCACAGGTGGAGGGAGG + Intergenic
1196951173 X:120876392-120876414 CTCAAAGAAAAGGTGGAGCTCGG - Intergenic
1196955426 X:120957067-120957089 CTCAAAGAAAAGGTGGAGCTCGG - Intronic
1198850050 X:140956602-140956624 CTGCAAGGAATGGTGGAAGTTGG + Intergenic
1200165695 X:154033636-154033658 CTGCAACAACAGGGGCAGCTTGG + Intronic
1201354471 Y:13082779-13082801 CAGCAAAGCCTGGTGGAGCTGGG - Intergenic
1201359315 Y:13129035-13129057 CTGCAAGAAGAGATGGGGCTTGG + Intergenic
1202372134 Y:24205758-24205780 CAGCAGGGAGAGGCGGAGCTGGG - Intergenic
1202498651 Y:25464358-25464380 CAGCAGGGAGAGGCGGAGCTGGG + Intergenic