ID: 1006747018

View in Genome Browser
Species Human (GRCh38)
Location 6:36350044-36350066
Sequence GCAAATTAGGTCCAGCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006747018_1006747022 22 Left 1006747018 6:36350044-36350066 CCACCGTGCTGGACCTAATTTGC No data
Right 1006747022 6:36350089-36350111 ACATCTTCTTAAATGCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006747018 Original CRISPR GCAAATTAGGTCCAGCACGG TGG (reversed) Intergenic