ID: 1006747302

View in Genome Browser
Species Human (GRCh38)
Location 6:36352323-36352345
Sequence GAGTGAATTTTAGCCAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006747302_1006747304 -1 Left 1006747302 6:36352323-36352345 CCAGGCCTGGCTAAAATTCACTC No data
Right 1006747304 6:36352345-36352367 CTTTAAAATGTACAGTTCTGTGG No data
1006747302_1006747305 0 Left 1006747302 6:36352323-36352345 CCAGGCCTGGCTAAAATTCACTC No data
Right 1006747305 6:36352346-36352368 TTTAAAATGTACAGTTCTGTGGG No data
1006747302_1006747306 1 Left 1006747302 6:36352323-36352345 CCAGGCCTGGCTAAAATTCACTC No data
Right 1006747306 6:36352347-36352369 TTAAAATGTACAGTTCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006747302 Original CRISPR GAGTGAATTTTAGCCAGGCC TGG (reversed) Intergenic
No off target data available for this crispr