ID: 1006747322

View in Genome Browser
Species Human (GRCh38)
Location 6:36352467-36352489
Sequence GGGGTGAGAGGGCCTGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006747322_1006747335 9 Left 1006747322 6:36352467-36352489 CCCTTCCCAGGCCCTCTCACCCC No data
Right 1006747335 6:36352499-36352521 TCAACCATTAATCTCCCACCTGG No data
1006747322_1006747338 14 Left 1006747322 6:36352467-36352489 CCCTTCCCAGGCCCTCTCACCCC No data
Right 1006747338 6:36352504-36352526 CATTAATCTCCCACCTGGCTGGG No data
1006747322_1006747337 13 Left 1006747322 6:36352467-36352489 CCCTTCCCAGGCCCTCTCACCCC No data
Right 1006747337 6:36352503-36352525 CCATTAATCTCCCACCTGGCTGG No data
1006747322_1006747339 17 Left 1006747322 6:36352467-36352489 CCCTTCCCAGGCCCTCTCACCCC No data
Right 1006747339 6:36352507-36352529 TAATCTCCCACCTGGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006747322 Original CRISPR GGGGTGAGAGGGCCTGGGAA GGG (reversed) Intergenic
No off target data available for this crispr