ID: 1006748096

View in Genome Browser
Species Human (GRCh38)
Location 6:36359143-36359165
Sequence CAGATTAAACAGAAAGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006748091_1006748096 -1 Left 1006748091 6:36359121-36359143 CCATCTTTCATGGTGTGACCTGC 0: 1
1: 0
2: 0
3: 39
4: 217
Right 1006748096 6:36359143-36359165 CAGATTAAACAGAAAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006748096 Original CRISPR CAGATTAAACAGAAAGGGGA TGG Intronic
No off target data available for this crispr