ID: 1006749319

View in Genome Browser
Species Human (GRCh38)
Location 6:36366689-36366711
Sequence GCCGCTGGAGAGCCAGGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 0, 3: 46, 4: 426}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006749319_1006749326 15 Left 1006749319 6:36366689-36366711 CCTGCTCCTGGCTCTCCAGCGGC 0: 1
1: 0
2: 0
3: 46
4: 426
Right 1006749326 6:36366727-36366749 TTGTCCTGGACCATCTTTCCCGG 0: 1
1: 0
2: 7
3: 24
4: 165
1006749319_1006749325 1 Left 1006749319 6:36366689-36366711 CCTGCTCCTGGCTCTCCAGCGGC 0: 1
1: 0
2: 0
3: 46
4: 426
Right 1006749325 6:36366713-36366735 CCAGGTGGCTGTGCTTGTCCTGG 0: 1
1: 0
2: 0
3: 31
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006749319 Original CRISPR GCCGCTGGAGAGCCAGGAGC AGG (reversed) Exonic
900577914 1:3393549-3393571 GACGCTCTCGAGCCAGGAGCCGG + Intronic
900647861 1:3717188-3717210 GCTGCCGGGGAGCGAGGAGCGGG + Intronic
901022756 1:6263283-6263305 GCCCCTGGAGAGCGAGGACTCGG - Intergenic
901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG + Intronic
901842866 1:11964779-11964801 GCAGCAGGTCAGCCAGGAGCGGG + Exonic
902226002 1:14996798-14996820 GGCCCTGGAGCACCAGGAGCGGG - Intronic
902369861 1:15999243-15999265 GCAGCTGGGGAGCCAGCAGAGGG + Intergenic
903294194 1:22333253-22333275 GCCGTGGCAGAGGCAGGAGCTGG - Intergenic
903759150 1:25685568-25685590 GCAGCTGGGGAGCAAGGTGCTGG + Intronic
903928584 1:26849296-26849318 GCCTCTGGAGAGCAGGGAGAGGG - Intronic
904013292 1:27402490-27402512 GCCACTGGGCAGCCAGGAGGGGG + Intergenic
904031170 1:27534156-27534178 TCCTCTGGAGAACCAGTAGCTGG + Intronic
904037292 1:27565563-27565585 GGCGCTGGTGAGCAAGGGGCGGG + Intronic
904365833 1:30010462-30010484 GCCCTTGGAGAGCTGGGAGCAGG - Intergenic
904832551 1:33314427-33314449 GCAGCAGGAGAGGCAGGGGCAGG - Intronic
904935831 1:34128861-34128883 GGGGCTGGAGAGCTGGGAGCTGG + Intronic
905183108 1:36178546-36178568 GCAGCGGGAGCGCGAGGAGCAGG + Exonic
905244171 1:36601196-36601218 AACCCTGGAGAGCCAGGAGCTGG - Intergenic
905804968 1:40869615-40869637 GCTGCTGGAGAGGCTGGGGCAGG + Intergenic
905866429 1:41379509-41379531 GGGGCTGGGGAGCCAGGTGCAGG + Intronic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
906528538 1:46510440-46510462 GCCGTTGGAGGGCAAGGAGAGGG - Intronic
906536995 1:46556501-46556523 GCCCCTGGAGACCCAGAACCAGG - Intergenic
906945125 1:50288746-50288768 GCCACTAAAGAGCCTGGAGCAGG - Intergenic
907439901 1:54472719-54472741 GCTGCTGGGGAGCCATGGGCTGG + Intergenic
912162822 1:107007033-107007055 GCAGTGGGAGATCCAGGAGCTGG - Intergenic
913269107 1:117075551-117075573 GCCGCTGGTCCTCCAGGAGCAGG - Exonic
914950749 1:152111299-152111321 GCTGCTGAAGAGCGAGGAGCAGG - Exonic
914950755 1:152111341-152111363 GCGGCTGAAGCGCGAGGAGCCGG - Exonic
914950788 1:152111644-152111666 GCGGCTGAAGCGCCAGGAGGAGG - Exonic
916894800 1:169151412-169151434 TCAGCTGGGGAGTCAGGAGCGGG - Intronic
917455632 1:175183465-175183487 GCCCCTGCAGAGCCAGGTGATGG + Intronic
917972884 1:180219904-180219926 GGCACTGGTGAGCCAGGAGGAGG - Intergenic
919713715 1:200753631-200753653 GCTGATGGAGACCCAGGAACTGG + Intronic
920237291 1:204516549-204516571 GGAGCTGGAGAGTGAGGAGCAGG + Intronic
922900594 1:229133554-229133576 GCCGCTGGAATGAGAGGAGCAGG - Intergenic
1062897815 10:1117787-1117809 GCCACTGCAGAGCCAGGGCCCGG + Intronic
1063572035 10:7224383-7224405 GACAGTGGAGAGCCAGGATCGGG - Intronic
1063983216 10:11473276-11473298 GGTGCTGGTGAGGCAGGAGCCGG + Intronic
1066349742 10:34626194-34626216 GACCCTGGACAGCCAGGAGTTGG + Intronic
1066485888 10:35844211-35844233 CCCACTGGAGAGCCATGTGCAGG - Intergenic
1067110461 10:43396719-43396741 GCTGCTGGAGTGCCGTGAGCAGG - Exonic
1069717684 10:70531418-70531440 CCGGGTGGAGAGCCTGGAGCTGG + Exonic
1070352953 10:75611051-75611073 GCTGCTGCAGAGGCTGGAGCTGG + Intronic
1070670748 10:78375657-78375679 GGCGCTGGAGGGACGGGAGCAGG + Intergenic
1070913522 10:80137962-80137984 GGCCCTTGAGAGGCAGGAGCAGG - Intronic
1071847474 10:89535516-89535538 GGCGCTGGGGATCCGGGAGCGGG + Exonic
1072217615 10:93300945-93300967 TCCCATGGAGAGCAAGGAGCTGG - Intergenic
1072682527 10:97517301-97517323 GCCACTGGAGAGCCTGGTGGTGG + Intronic
1073073803 10:100810797-100810819 GCCACAGGAGACCCAGGGGCTGG + Intronic
1073324394 10:102634074-102634096 AGCCCTGGAGAGGCAGGAGCTGG - Intergenic
1073326293 10:102645543-102645565 GCAGCTGGAGAGGCAGGACCGGG - Intronic
1074903414 10:117839302-117839324 ACCGATGGGGAGCCAGGAGGGGG - Intergenic
1075726373 10:124612902-124612924 GCCCCTGGGGAGCCCAGAGCAGG + Intronic
1076084166 10:127610617-127610639 GACGACGGGGAGCCAGGAGCTGG - Intergenic
1076320984 10:129581255-129581277 GCCACTGCAGAACCAGGGGCAGG - Intronic
1076329594 10:129654651-129654673 GTCCCTGGAGAGACAGGAGGAGG + Intronic
1076373515 10:129969103-129969125 GCCGCTGCGCAGCCGGGAGCCGG + Intergenic
1076585934 10:131547684-131547706 GCCTCTGGGCACCCAGGAGCGGG - Intergenic
1076695451 10:132245184-132245206 GCAGCTGTACAGCCAGGAGCAGG + Intronic
1077034040 11:486339-486361 ACCGCTGGACAGACGGGAGCGGG - Intronic
1077081330 11:725935-725957 GCGGCTGGAGAGACTGGGGCAGG + Intronic
1077209320 11:1361197-1361219 CCCAGTGGAAAGCCAGGAGCTGG + Intergenic
1077262193 11:1628760-1628782 GCCGGTGGAGAGCAGGGAACCGG - Intergenic
1077433405 11:2526941-2526963 GCGACCGGAGAGCCAGGAGATGG - Intronic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1078665810 11:13324237-13324259 GCCGCTGGAGAGTTTAGAGCAGG - Intronic
1080012422 11:27472317-27472339 GCCGCGGGAGAGGCCGGCGCGGG - Exonic
1081597870 11:44471707-44471729 GCCCCAGGAGAGCAAGGATCTGG - Intergenic
1082790724 11:57345138-57345160 GAAGCTGCAGAGCCAGGAGCTGG - Intronic
1083294491 11:61707777-61707799 GCAGGTGGAAAGACAGGAGCTGG + Intronic
1083399468 11:62413820-62413842 GCCTCTCCAGAGCCAGAAGCGGG - Intronic
1083636873 11:64125555-64125577 GCTGCTGGCGGGGCAGGAGCAGG - Intronic
1083735082 11:64675590-64675612 GCTGCTGCAGAGCCAGGACTGGG + Intronic
1083799260 11:65037008-65037030 AACCCTGGAGAGGCAGGAGCAGG - Intronic
1084222044 11:67688160-67688182 GCCTTTGGAAAGCCAGGAGGAGG + Intergenic
1084557359 11:69883041-69883063 GCAGCTGGAGCCCCAGAAGCTGG - Intergenic
1084891540 11:72239382-72239404 GCCGCTGCAGAGCCAGGGAAGGG + Exonic
1084957046 11:72697118-72697140 GCTGCTGGAGAGCCTGCGGCAGG - Exonic
1087012297 11:93525560-93525582 CCTGCAGGAGAGCCAGGAGTGGG - Intronic
1089945061 11:122462028-122462050 GCAGCTGGAGAGGTAGGGGCTGG - Intergenic
1089954468 11:122556951-122556973 GCTGCTGGAGAGCCGGGGCCAGG + Intergenic
1090204384 11:124876533-124876555 GCCGCTGGCGAGTGAGGACCGGG + Intronic
1090797880 11:130150891-130150913 GCCGCTGCCGTCCCAGGAGCAGG - Intergenic
1092190052 12:6512635-6512657 GCCACTGGGGAGCCACAAGCAGG + Intronic
1093935255 12:24993942-24993964 GCAGATGGAGGGCCAGGAGGAGG - Exonic
1094437064 12:30432300-30432322 GCTGCTGCAGAGCAAGTAGCTGG + Intergenic
1094494562 12:30981257-30981279 GCTGCTGGAGGGCCGGGTGCTGG - Intronic
1095950662 12:47780160-47780182 GACGCTGGAGAGGTAGTAGCTGG - Exonic
1096092783 12:48914478-48914500 GCCTCTGCAGGGCCAAGAGCTGG - Exonic
1096103895 12:48985706-48985728 GACGCTGGTGAGCGAGCAGCAGG + Intergenic
1096148611 12:49295307-49295329 GCTGCTGGAGAAGCGGGAGCTGG - Exonic
1096243832 12:49973592-49973614 GCACCTGGAGGGCCAGGAGGCGG + Intronic
1096522377 12:52191650-52191672 GCAGCTGAAGAACCAGGAGAAGG - Exonic
1096551866 12:52378307-52378329 GCCGCGGGAGAGGGTGGAGCCGG + Exonic
1096944224 12:55386305-55386327 GCAGCTGGAGATCCAGGAAAGGG - Intergenic
1097191055 12:57219852-57219874 GGAGCTGGAGACCCAGGAGCGGG + Intronic
1098951480 12:76644877-76644899 TGCTCTTGAGAGCCAGGAGCAGG + Intergenic
1099681207 12:85830312-85830334 ACCACTTGAAAGCCAGGAGCTGG + Intronic
1099761926 12:86934249-86934271 GCTACTGGAGAGCCTGAAGCAGG - Intergenic
1101487678 12:105182135-105182157 GCTACTGGAGAGGCTGGAGCAGG - Intronic
1101716837 12:107319339-107319361 GACGCTGGTGAGCCGGGCGCTGG + Exonic
1102212615 12:111138326-111138348 GGCGCTGGGGAGCCAGCAGGGGG + Intronic
1102882642 12:116497510-116497532 GCCACTGGCCAGCCAGCAGCAGG - Intergenic
1103608702 12:122107722-122107744 GCCACAGGAGAGCCGGGAGAGGG - Intronic
1104676206 12:130714180-130714202 GCGGGAGGAGAGGCAGGAGCTGG - Intronic
1104743884 12:131198339-131198361 GCCACTGCAGATCCTGGAGCAGG - Intergenic
1104811296 12:131621868-131621890 GCAGCAGGAGAGCCAGGAGGAGG - Intergenic
1104857909 12:131910442-131910464 GCTGCAGCAGAGCAAGGAGCCGG - Intronic
1104924699 12:132308158-132308180 GCGCCTGGAGCCCCAGGAGCTGG + Intronic
1105020474 12:132813378-132813400 GCCCCTGGAGAAGGAGGAGCAGG - Exonic
1107467925 13:40666235-40666257 GCCGCAGGAGAGCCAAGAGGGGG + Exonic
1110119597 13:71865762-71865784 GCGGCTGGCGAGCCCCGAGCAGG + Intronic
1112809064 13:103196722-103196744 GAAGCTGGAGAGCCTGCAGCAGG - Intergenic
1112962199 13:105140179-105140201 GCAGCTGGAGACCCATGAGATGG - Intergenic
1113577289 13:111403518-111403540 GCCGCAGGAGAACCAGCATCAGG + Intergenic
1115257608 14:31420007-31420029 GCCAGTGGTCAGCCAGGAGCCGG - Intronic
1115398858 14:32937335-32937357 GCCGCGGGAGTGACAGGAGTGGG + Intronic
1118849343 14:69572476-69572498 GCGGCGGGAGCGCGAGGAGCGGG - Exonic
1121310415 14:92932629-92932651 GCGGCTGGAGGGGCAGGAGGAGG + Exonic
1122292409 14:100686864-100686886 GGGGCTGGAGAGGCAGGAGGGGG + Intergenic
1123018956 14:105388660-105388682 GCCCCTGGAGCGCCGGGGGCAGG - Intronic
1123058619 14:105584291-105584313 GCCGCAGGAGACCCTGGAGGAGG - Intergenic
1123082950 14:105704525-105704547 GCCGCAGGAGACCCTGGAGGAGG - Intergenic
1124006671 15:25800396-25800418 TCCCCTGGGGAGGCAGGAGCAGG - Intronic
1125181802 15:36887410-36887432 GCCGCGGAAGAGGCAGGAGAGGG + Intergenic
1125200062 15:37095385-37095407 GGAGCTGGCGAGCGAGGAGCAGG - Intronic
1125609248 15:40959752-40959774 GCTCCTGGAGAGCCAGGAGTCGG + Intergenic
1125722844 15:41853419-41853441 GGCACAGGAGAGGCAGGAGCTGG - Exonic
1125727958 15:41877760-41877782 GCCGCTGCAGAACCAGGTACTGG + Intronic
1127793935 15:62422645-62422667 GCTGCTGGAGTGCCAGGAGATGG - Intronic
1127918722 15:63476520-63476542 GCAGCTGGAAGACCAGGAGCAGG + Intergenic
1127931020 15:63597616-63597638 GCGGCTGGAGTGCCAGCAGATGG - Exonic
1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG + Intergenic
1129540912 15:76346529-76346551 GCCTCTGGAGAGCCGGGGGGCGG + Intergenic
1129716261 15:77852843-77852865 GGAGCAGGAGAGGCAGGAGCGGG + Intergenic
1130077726 15:80704231-80704253 GCAGCTGGAGAGAGAGGAACAGG - Intronic
1130896595 15:88174805-88174827 GCCGCTGGAGGGCTCTGAGCAGG - Intronic
1131161144 15:90105662-90105684 GCCCCTGGAGAGCCTGGGGGAGG + Intergenic
1132115387 15:99131934-99131956 GCCTCTGGACAGGCAGGGGCAGG - Exonic
1132151925 15:99468015-99468037 GCAGCTGCAGAGCCCTGAGCTGG + Intergenic
1132838906 16:1968718-1968740 GCCGCAGGAGGGACAGCAGCAGG - Exonic
1133263846 16:4571217-4571239 GCCACTGGAGGATCAGGAGCAGG - Intronic
1133775828 16:8894435-8894457 GCCAGTGGAGAGAGAGGAGCTGG + Intronic
1133998118 16:10762831-10762853 GCCCGTGGAGAGCCTGGAGGCGG + Intronic
1134172107 16:11976854-11976876 GCAGCTGGAGCGGCGGGAGCCGG - Intronic
1134247633 16:12551837-12551859 GCTGCTGGGGACACAGGAGCAGG + Intronic
1136116743 16:28099341-28099363 GCCCCAGCAGAGCCATGAGCAGG + Intronic
1136723676 16:32341545-32341567 GCCAGTGCAGAGCCAGGAGAGGG + Intergenic
1137613493 16:49834466-49834488 TCTGCTGGAGAGGCTGGAGCCGG - Intronic
1138247009 16:55475202-55475224 GCCACTGTGGAGCCAGGAGGTGG + Intronic
1138450486 16:57091289-57091311 GCAGCAGGAGAGCCAGGCACTGG - Intergenic
1138459200 16:57138079-57138101 GGCGCTGGAGCGTGAGGAGCAGG - Intronic
1139654745 16:68380549-68380571 GGCGCTGGTCAGCCGGGAGCAGG - Intronic
1142412607 16:89924038-89924060 GCCGATGGAGAGCCTGGTCCTGG - Intronic
1203002755 16_KI270728v1_random:176220-176242 GCCAGTGCAGAGCCAGGAGAGGG - Intergenic
1203134361 16_KI270728v1_random:1712626-1712648 GCCAGTGCAGAGCCAGGAGAGGG - Intergenic
1142767112 17:2071115-2071137 GCAGCTGGAGTGACAGGGGCTGG + Intronic
1143474658 17:7195802-7195824 GCCGCTGGAGAGACGGGGGCAGG + Intronic
1144767683 17:17741584-17741606 CCATCTGGAGACCCAGGAGCAGG - Intronic
1145098622 17:20054307-20054329 GCTGCAGGAGAGACAGGAGCTGG - Intronic
1147514365 17:41101871-41101893 GCTGCTGGAGATGCAGCAGCTGG + Exonic
1147516584 17:41123673-41123695 GCTGCTGGAGATGCAGCAGCTGG + Exonic
1147517952 17:41140041-41140063 GCAGCTGGAGATGCAGCAGCTGG + Exonic
1147518887 17:41149378-41149400 GCAGCTGGAGATGCAGCAGCTGG + Exonic
1147520488 17:41167756-41167778 GCAGCTGGAGATACAGCAGCTGG + Exonic
1147768905 17:42854548-42854570 GCTGCTGGAGATGGAGGAGCAGG + Exonic
1148112070 17:45150114-45150136 GCGGCTGGAGAGCAAGCGGCTGG + Exonic
1148158658 17:45437567-45437589 GACGCTGGTGAGCCAGGGCCTGG + Exonic
1148783963 17:50136179-50136201 TCAGCTGCAGAGCCTGGAGCAGG - Exonic
1148860204 17:50600655-50600677 TCTGCTGAGGAGCCAGGAGCCGG + Intronic
1149491851 17:57090921-57090943 GCCTTTGGAGGGCCAGGAGATGG - Intronic
1150390079 17:64784966-64784988 GACGCTGGTGAGCCAGGGCCTGG + Intergenic
1151675600 17:75595840-75595862 GCCTCAGGACAGCCAGGAGGGGG + Intergenic
1151823135 17:76507939-76507961 GCCACTGGAGATCCTGGAACAGG - Intergenic
1151825272 17:76520563-76520585 GCCACTGGAGATCCTGGAACAGG + Intergenic
1151873408 17:76851698-76851720 GCTGCTGGAGACCCAGGAAATGG - Intergenic
1151947845 17:77329238-77329260 GCAGCTGGAGAGGGAGGATCAGG + Intronic
1151966792 17:77435735-77435757 GCTGCAGGACAGCCAGGAGGAGG - Intronic
1151969556 17:77450723-77450745 GAGGCTGGAGAGGCAGGAGCTGG + Intronic
1152112834 17:78366526-78366548 GCCCTTGGAGAGGCAGGAGCTGG + Intergenic
1152434041 17:80264365-80264387 GCCAGTGGAGAGACAGGAGCGGG + Intronic
1152599240 17:81253166-81253188 GCCGAAGGAGAGAGAGGAGCTGG - Exonic
1152630669 17:81409455-81409477 GGTTCTGGAGGGCCAGGAGCGGG + Intronic
1152730644 17:81967977-81967999 GCCGCTGTTGCGGCAGGAGCAGG - Intergenic
1152854805 17:82658653-82658675 GCCGCTTGAACGCCAGGTGCAGG + Exonic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1154166108 18:12015574-12015596 GCTGCAGGAGAGCCCAGAGCAGG + Intronic
1154304922 18:13223610-13223632 GCCGCTGGAGAGGCTGTAGGAGG + Intronic
1155564695 18:27121112-27121134 GCTGCTGGAGAGCCTGAGGCGGG - Intronic
1157752970 18:50194820-50194842 GCCGCGGGGCAGCCAGGAGCCGG - Exonic
1159142409 18:64413602-64413624 GCTGCTGGAGAGACTGGGGCAGG + Intergenic
1160214467 18:76915835-76915857 GCCACTGGAGAGACAGAAGGAGG + Exonic
1160547872 18:79673038-79673060 TCAGCTGCACAGCCAGGAGCGGG - Intergenic
1160735186 19:659117-659139 GACGCTTGAGAGGCAGGGGCAGG + Intronic
1160792619 19:929570-929592 GCAGCGGGCGCGCCAGGAGCTGG + Exonic
1162397477 19:10425433-10425455 GGTGCTGGGCAGCCAGGAGCTGG + Intronic
1162417021 19:10544229-10544251 GCCCCGGGAGAGCCAAGAGCGGG - Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162683851 19:12365636-12365658 TCAGCTACAGAGCCAGGAGCGGG + Intronic
1163112699 19:15170906-15170928 GGCGCTTCAGAGCCAGGCGCTGG - Intronic
1163574033 19:18099970-18099992 TCCTCTGGAGGGCTAGGAGCAGG + Intronic
1163602151 19:18255603-18255625 GCAGCTGTGGAACCAGGAGCAGG - Intergenic
1163757152 19:19112892-19112914 GCCAAAGAAGAGCCAGGAGCAGG - Intergenic
1164105350 19:22105378-22105400 GCGGCTGGCGGGCCAGGGGCTGG - Intergenic
1164156983 19:22602983-22603005 GCTGCTGGAGTTGCAGGAGCTGG + Intergenic
1165455496 19:35908177-35908199 CCAGCAGGAGAGGCAGGAGCAGG + Exonic
1165459493 19:35936415-35936437 GCCGCGGGAGCGCCTGGACCCGG + Intronic
1165847573 19:38828341-38828363 GCTGCTGGAGAGCCTGAGGCAGG - Intronic
1166100035 19:40566230-40566252 GCTCCTGCAGAGCCGGGAGCTGG + Exonic
1166326050 19:42051824-42051846 GCGGCAGGAGGGGCAGGAGCTGG - Intronic
1166865876 19:45836748-45836770 GCCACTGGAGAGGCTGAAGCAGG - Intronic
1167134981 19:47610356-47610378 GCCGCGGGAGAGCTAGGCTCGGG + Intronic
1167145998 19:47681072-47681094 GCTGCTGGAGGCCCAGGGGCAGG - Exonic
1167233073 19:48297500-48297522 GCAGGTGGAGCTCCAGGAGCAGG - Exonic
1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG + Exonic
1167483468 19:49746687-49746709 GCCGGAGGAGAAGCAGGAGCCGG - Exonic
1167483472 19:49746705-49746727 GCCGGAGGAGAAGCAGGAGCCGG - Exonic
1167740904 19:51324479-51324501 GCACCTGGAGAGACAGGACCTGG + Intronic
1168063849 19:53908610-53908632 GCCGCCGCGGAGCCAGGAGCCGG - Intergenic
925216078 2:2096958-2096980 GCCGCTGGCGTGAGAGGAGCTGG - Intronic
925608593 2:5684108-5684130 GCTGCTGGGGAACCAGGAGATGG - Intergenic
927419227 2:22912611-22912633 GCAGCTGGAGCGCCAGAAGCAGG + Intergenic
927506521 2:23618612-23618634 CAAGCTGGAGACCCAGGAGCGGG - Intronic
928245766 2:29625774-29625796 GCTGCTGGAGGGCCAGGCTCTGG + Intronic
928437670 2:31266212-31266234 GCCGCTGAAGAGCAAGCTGCTGG + Exonic
929600172 2:43199774-43199796 GGGGCTGGAGAAGCAGGAGCTGG + Intergenic
931670830 2:64645241-64645263 GCAGCGGGAGAGCCCGGAGGAGG - Intronic
932332564 2:70906064-70906086 ACCCTTGGAGAGCCAGTAGCCGG + Intronic
932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG + Exonic
934462064 2:94217774-94217796 GCCAGTGGAGAGCAAGGAACAGG - Intergenic
934502573 2:94871774-94871796 GCGGCACGAGAGCCAGCAGCTGG + Exonic
934664286 2:96158902-96158924 GTCGCGAGAGAGCCAGGAGCTGG + Intergenic
934941182 2:98503359-98503381 GGGGCTGGAGAGCCAGGACGAGG - Intronic
935281524 2:101521964-101521986 GCACCAGGAAAGCCAGGAGCAGG + Intergenic
935626430 2:105175725-105175747 ACAGCTGGAGAGCCGGAAGCTGG - Intergenic
937259900 2:120578591-120578613 GCTGCTGCAGAGCCAGGGCCTGG - Intergenic
937882381 2:126878083-126878105 GCCGGTGGTGAGCCAGCATCCGG - Intergenic
937892449 2:126948902-126948924 GCAGCTAGAAAGCCAGGAGGGGG - Intergenic
937979600 2:127607250-127607272 GCCGCTGGCGAGGCAGTACCAGG + Exonic
938266050 2:129929074-129929096 GGCCCTTGAGAGGCAGGAGCAGG + Intergenic
938795899 2:134718444-134718466 GGCGCCGGAGGGCCTGGAGCTGG + Intronic
939152816 2:138493456-138493478 GCCGCTGGGGAGACAGCTGCAGG + Intergenic
940001029 2:148966302-148966324 GCTGCTGGAGAGCAAGGAAGGGG + Intronic
942045566 2:172097386-172097408 TACGCTGGAGAGCCCGGGGCAGG - Intergenic
942046358 2:172101539-172101561 GCCGCTGAAGAGCCGCCAGCTGG + Exonic
942278965 2:174342303-174342325 GCGGCTGGGCAGGCAGGAGCCGG + Intergenic
944402915 2:199348880-199348902 GATGCTGGTGAGCCAGGAGCCGG + Exonic
945762401 2:213930067-213930089 GCCGCAGGAGTGCCATGTGCAGG - Exonic
946023698 2:216659206-216659228 GCTGCTGGAGTGCCAGCACCCGG + Intronic
946145264 2:217725790-217725812 CCGGCTGGAGAGCAGGGAGCAGG + Intronic
946277508 2:218642551-218642573 TCTGCAGGAGAGCCAGGGGCAGG + Exonic
946403765 2:219482427-219482449 GGAGCTGGGGAGCCAGGACCCGG + Intronic
948381098 2:237550472-237550494 GCTCCTGGAGAGCCATGTGCTGG + Intronic
948772311 2:240257992-240258014 GGCGGCGGAGAGCCAGGAGCGGG + Intergenic
948899591 2:240949642-240949664 GGCCCTGGAGAGCCAGGCGTTGG + Intronic
1169084238 20:2816860-2816882 GCAGCAGGAGAGCCGGTAGCAGG - Exonic
1169091254 20:2862605-2862627 CCTGCGGGAGATCCAGGAGCTGG + Exonic
1171235507 20:23521087-23521109 GGTTCTGAAGAGCCAGGAGCAGG + Intergenic
1171469320 20:25357178-25357200 GGCGCTGGAGAGTCAGGGGTTGG - Intronic
1171986378 20:31664390-31664412 GCCGCTGGAGAGCTGGGTACTGG - Intergenic
1172033496 20:31996913-31996935 GCGGCTGGAGTACCAGAAGCCGG - Exonic
1172221932 20:33280137-33280159 GACGCTAGAGAACCAGGGGCTGG - Intronic
1172754042 20:37270956-37270978 GCCACTGGGGAGTCAGGAGCTGG - Intergenic
1174097533 20:48101250-48101272 GGTGCTGCAGAGCCAGGATCAGG + Intergenic
1174629001 20:51940209-51940231 GCAGCCGGAAAGCCAGGAGAGGG + Intergenic
1175335983 20:58196617-58196639 TGCGCTGGAGAGCCAGGTGGGGG - Intergenic
1175465834 20:59191074-59191096 GCCCCTGGAGGGCCAGGAGTGGG - Exonic
1175547179 20:59785910-59785932 GCCGTTGGAAAACCAGAAGCAGG - Intronic
1175717965 20:61268141-61268163 GCAGCTGGAGAGCCAGTGCCTGG + Intronic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1175950927 20:62582589-62582611 GCAGCTGGGGAGCCTGGAGAAGG + Intergenic
1175980131 20:62734556-62734578 ACCCCTGGGGAGCGAGGAGCAGG + Intronic
1176021096 20:62962822-62962844 GCCGCTGAGCAGCCTGGAGCAGG + Intronic
1176212287 20:63930790-63930812 GCCCCTGGAGAGGGAGGCGCAGG - Intronic
1176284501 21:5012367-5012389 GCTGCTGGAGGGACAGGGGCAGG + Intergenic
1176649096 21:9529470-9529492 GCGGCTGGAGAGGTAGGAGAAGG - Intergenic
1176958999 21:15138716-15138738 GCTGCTGGAGACCCAGCTGCGGG + Intergenic
1178373887 21:32050519-32050541 GCCTCTGGCCAGCCAGGAGGCGG - Intergenic
1178513801 21:33229833-33229855 GCCGCTGGCGGGGCTGGAGCAGG - Intergenic
1179134803 21:38670011-38670033 GCCTCTGGGGAGTGAGGAGCTGG - Intergenic
1179513738 21:41892280-41892302 GGAGCTGGAGAGGCGGGAGCAGG + Intronic
1179872680 21:44251108-44251130 GCTGCTGGAGGGACAGGGGCAGG - Intronic
1179890319 21:44331847-44331869 CCCGCTGGACAGCGAGGAGGAGG - Exonic
1179936975 21:44612258-44612280 GCAGCTGGAGGCACAGGAGCGGG - Exonic
1180796773 22:18609673-18609695 GCGGCGCGAGTGCCAGGAGCTGG - Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181147418 22:20858759-20858781 GGCGCTCGCGGGCCAGGAGCGGG - Exonic
1181224951 22:21385598-21385620 GCGGCGCGAGTGCCAGGAGCTGG + Exonic
1181253681 22:21549215-21549237 GCGGCGCGAGTGCCAGGAGCTGG - Exonic
1182442725 22:30373629-30373651 GCAGCTGGACAGCCTGGACCAGG + Exonic
1183162486 22:36124167-36124189 GCCTCGGCAGAGCCAGGAGGTGG - Intergenic
1183474798 22:38030257-38030279 CCCCCTGGGGAGCCAGGAGTCGG + Intronic
1183736018 22:39645396-39645418 GCAGCTGCAGAGGCAGGGGCGGG + Intronic
1184660272 22:45962439-45962461 GCCCCTGGAGGGGGAGGAGCTGG - Intronic
1184771340 22:46598574-46598596 CCCACAGGTGAGCCAGGAGCCGG - Intronic
1184805523 22:46792814-46792836 CCCTGGGGAGAGCCAGGAGCTGG + Intronic
1185075162 22:48679028-48679050 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185075229 22:48679220-48679242 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185075426 22:48679734-48679756 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185119462 22:48957425-48957447 GTCACTCAAGAGCCAGGAGCAGG - Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
949580996 3:5388182-5388204 GTGGCTGGAGAGATAGGAGCTGG + Intergenic
950396960 3:12740968-12740990 GCATCTGGATAGCCTGGAGCAGG - Intronic
950455228 3:13088772-13088794 GGGGCAGGAGAGCCTGGAGCTGG - Intergenic
952858928 3:37796016-37796038 TATGCTGGAGAGACAGGAGCTGG - Intronic
953883887 3:46704891-46704913 GTCCCTAGACAGCCAGGAGCAGG + Intronic
953885438 3:46712272-46712294 GCAGTGGGAGTGCCAGGAGCAGG + Exonic
954005621 3:47588222-47588244 GAGGCTGGCGGGCCAGGAGCAGG + Exonic
954034356 3:47842944-47842966 GCTGCTGCATAGCCAGGAGCAGG - Intronic
954115967 3:48466973-48466995 GCCGCAGGAAGGCTAGGAGCAGG - Exonic
954154714 3:48679064-48679086 GCAGGTTGAGAGCCAGAAGCAGG + Exonic
955927631 3:64023395-64023417 GCCGCTGGAGAACCTGGAGGAGG - Exonic
956713503 3:72058636-72058658 GCCGCCAGAGAGCCGGCAGCCGG - Intergenic
956806768 3:72821982-72822004 GTCACAGGAGAGCCAGGAGTTGG - Intronic
958798730 3:98732875-98732897 GCCGCGAGAGAGGCAGCAGCCGG + Exonic
960969894 3:123131834-123131856 GCCGCGTGAGAGCCAGGGGATGG + Intronic
960998083 3:123352431-123352453 GCAGCGGGAGAACCAGCAGCAGG - Exonic
961033991 3:123629623-123629645 GACTCTGGAGAGACAAGAGCAGG + Exonic
961539802 3:127591572-127591594 ACAGGTGTAGAGCCAGGAGCAGG - Intronic
962456849 3:135572778-135572800 GCTGCTGGAGAGCGAGGACAGGG - Intergenic
964569279 3:158094730-158094752 GACCCTGGAGACCCTGGAGCAGG - Intergenic
964744749 3:160001866-160001888 GCGGCTGCAGAGCCAGGATCAGG + Intergenic
965784099 3:172318257-172318279 GCCCCTGGGGAGCCATTAGCAGG + Intronic
966677102 3:182601491-182601513 GCCGATGGAAAGTCAGAAGCAGG - Intergenic
967281222 3:187825923-187825945 GCTGCTGGGGAAACAGGAGCAGG - Intergenic
967978070 3:195046457-195046479 GCCTCTGATGAGCCAGGAGAGGG + Intergenic
969113852 4:4859657-4859679 GCCGCGGTAGGGCCCGGAGCCGG + Exonic
969611844 4:8231977-8231999 GCCGCTGGACGGCCCGCAGCTGG - Exonic
971145627 4:23973298-23973320 GCCTTTGGAGAGCCAAGACCAGG - Intergenic
975646169 4:76548199-76548221 GCCGCTGGAAGGCCAGGGGCTGG + Intronic
977231043 4:94451877-94451899 GGCGAGGGAGAGCCAGGAGGCGG + Exonic
977991469 4:103447531-103447553 CCCGCTGGAGAGGCTGGAGGAGG + Intergenic
978791259 4:112665617-112665639 GCCGCTGGAGAGGCTGAGGCAGG + Intergenic
982745675 4:159102921-159102943 GCCGCTGGCGGGCGGGGAGCGGG + Intergenic
983402572 4:167284108-167284130 GGGGGTGGAGAGCCAGGGGCAGG - Intergenic
984337971 4:178416154-178416176 GCCAAGGGAGAGCCAGGCGCAGG - Intergenic
984951278 4:185009549-185009571 GCCCCTGGAGCCCCAGAAGCTGG + Intergenic
985445457 4:190019004-190019026 GGAGCTGGAGAGCCAGGGGAAGG + Intergenic
985471278 5:48439-48461 GCGGCTGGAGAGCAGGGTGCAGG + Intergenic
987099830 5:14581952-14581974 GCCGCAGGTGAGCCTGGGGCCGG + Exonic
989195312 5:38710640-38710662 GCAGCTGGAGACCTAGGTGCCGG + Intergenic
990715264 5:58629331-58629353 GCAGCTGGAGAGCCAGGCAGGGG + Intronic
992807482 5:80351806-80351828 GACGCTGGAGGGCCGGGAGAAGG - Intergenic
994631811 5:102296367-102296389 GAGGCTGGAGGGCCAGGAGGCGG - Exonic
997527197 5:134561019-134561041 GCCCCTGGAGAGCCAAGTGGGGG - Intronic
997882730 5:137604777-137604799 GCTGCTGGAGAGTGCGGAGCTGG - Intergenic
998285608 5:140857608-140857630 GCCGCTGGACCACGAGGAGCTGG + Exonic
998629244 5:143880258-143880280 GAAGCTGGAGAGACTGGAGCAGG + Intergenic
998968036 5:147561987-147562009 GCCACTGGGGAGCCTGAAGCAGG - Intergenic
999303466 5:150505252-150505274 GCTGGTGGACAGCCGGGAGCAGG - Intronic
999341826 5:150779320-150779342 GGGCCTGGAGAGCCAGGAGGTGG - Intronic
999447560 5:151652265-151652287 GCCGTTGGTGGGGCAGGAGCTGG + Intergenic
1001774038 5:174315460-174315482 GCCACTGGAGAGCTCAGAGCAGG + Intergenic
1001835963 5:174832730-174832752 GCTTGTGGAGAGCCAGCAGCAGG - Intergenic
1002123358 5:177022810-177022832 GTTGCTGGAGGGCCAGGAGCCGG + Exonic
1002191474 5:177480089-177480111 GCCTAGGGAGAGCCAGGAGCAGG - Intergenic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1002273215 5:178086497-178086519 GCCGCTGCGGAGCGCGGAGCTGG - Intergenic
1002336580 5:178483471-178483493 GGTGCTGGAAAGCCAGGAGAAGG - Intronic
1002428059 5:179187339-179187361 GCCGCTGGAGCACAGGGAGCAGG - Intronic
1002522034 5:179797414-179797436 GCAGCTGCACAGCCAGGGGCTGG + Intergenic
1002782028 6:374260-374282 GCCCCTGGCGAGCAGGGAGCTGG - Intergenic
1003291993 6:4787881-4787903 GCCACTGGAGAGGCAGAGGCAGG - Intronic
1005320671 6:24649898-24649920 GCAGCAGTAGAGCCAGAAGCAGG + Intergenic
1006443881 6:34068226-34068248 GCAGCTGGAGAGGCAGAGGCTGG + Intronic
1006514741 6:34539559-34539581 GCCGCTGCAGGGCAAGGAGAGGG + Exonic
1006581259 6:35079068-35079090 TTCCCTGGGGAGCCAGGAGCTGG + Intronic
1006718097 6:36132726-36132748 GCCGCTGGGGAGCAAGGTGGGGG + Intronic
1006749319 6:36366689-36366711 GCCGCTGGAGAGCCAGGAGCAGG - Exonic
1007373812 6:41443219-41443241 GCACCTGGAGAAACAGGAGCTGG + Intergenic
1011441427 6:87391272-87391294 GCCCCTAGAGAGCCGGGTGCAGG - Intronic
1012466353 6:99520979-99521001 GGCGCCGGAGAGCCTGGAGCAGG + Intronic
1013099475 6:106974852-106974874 GGCGCTGGGGAACCCGGAGCGGG - Intronic
1015275045 6:131375521-131375543 ACTGCTGGAGGGCCAGAAGCTGG - Intergenic
1015544937 6:134352161-134352183 GCAGCTGGAGGGCTAGGAGCTGG - Intergenic
1018152334 6:160951925-160951947 ACGGCTGGAGAGACAGGAGCAGG + Intergenic
1019417243 7:933474-933496 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417254 7:933504-933526 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417270 7:933541-933563 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417301 7:933631-933653 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417312 7:933661-933683 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417323 7:933691-933713 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417354 7:933781-933803 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417395 7:933901-933923 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417416 7:933961-933983 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417427 7:933991-934013 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417455 7:934081-934103 GGTGCTGGAGAGCCGGGAGCCGG + Intronic
1019417466 7:934111-934133 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417487 7:934171-934193 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417498 7:934201-934223 GGTGCTGGAGAGCCGGGGGCCGG + Intronic
1019417526 7:934291-934313 GGTGCTGGAGAGCCGGGAGCCGG + Intronic
1019417536 7:934321-934343 GGTGCTGGAGAACCAGGGGCTGG + Intronic
1019474421 7:1236944-1236966 CCCGCCGGAGGGCGAGGAGCTGG + Exonic
1021968067 7:25941538-25941560 GCTACTTGAGAGCCTGGAGCAGG - Intergenic
1022473924 7:30698262-30698284 TCCGCAGGAGAGCTAGGCGCAGG + Intronic
1022505959 7:30908750-30908772 GCCGCTGGAGCCCCAGGCCCAGG - Intergenic
1024260497 7:47570711-47570733 TCCTCTGGACAGCCAGGGGCTGG - Intronic
1025929366 7:65982060-65982082 GTCGCGGGAGTGCAAGGAGCTGG - Exonic
1026797264 7:73374325-73374347 GCTGCTGGAGAGGCTGAAGCGGG + Intergenic
1027219106 7:76202543-76202565 GCCCCTAGGGAGGCAGGAGCTGG + Intronic
1027232990 7:76282764-76282786 GCGGCTGGAGCTCCAGGAGCGGG - Exonic
1029110901 7:98212537-98212559 GCGGCTGGAGAGCAACGAGAGGG + Exonic
1029565315 7:101333136-101333158 ACCACTGGAGAGCCAGGAAGTGG + Intergenic
1030216015 7:107044652-107044674 GCGGCTGGAGCGGGAGGAGCAGG + Exonic
1031979051 7:128112604-128112626 GCCGCTGGAGAGGGAGCAGGAGG - Intergenic
1033050687 7:138001678-138001700 GGTGCTGGAGAGCGGGGAGCAGG - Exonic
1034285419 7:149880525-149880547 GCAGCTGGCCAGCCAGGAACTGG - Exonic
1034358416 7:150472538-150472560 AGCCCTTGAGAGCCAGGAGCTGG - Intronic
1034778656 7:153856153-153856175 GCCACTGGAGTGGCAGGAACAGG - Intergenic
1034976695 7:155453391-155453413 GGCGCTGGAGAGCCGGAAGGGGG + Intergenic
1035324586 7:158056652-158056674 GACGCTGGAGAAGCAGCAGCAGG - Intronic
1035724894 8:1818172-1818194 GCCGCTCCAGAGCCAGGGACTGG + Intergenic
1035817980 8:2561768-2561790 CCAGCTTGGGAGCCAGGAGCAGG - Intergenic
1037248901 8:16869489-16869511 GCCACAGGAGAGCCAGGAGTAGG - Intergenic
1037508527 8:19557392-19557414 GACGTTGGAGAGTCTGGAGCTGG - Intronic
1037974328 8:23199319-23199341 GCAAATGGAAAGCCAGGAGCCGG - Exonic
1038798300 8:30728048-30728070 GCCGCTCGGGATCCAGGGGCCGG - Intergenic
1039474654 8:37833328-37833350 GCCTGTGCAGAGCCAGGAGCCGG + Intronic
1041491479 8:58438065-58438087 GCGGCTGGAGATGCAGCAGCTGG - Intronic
1042527066 8:69774369-69774391 GCCTGTGGAGAGCCTGGAGAAGG - Intronic
1042575797 8:70217359-70217381 GCTGCAGGAGAGCCAGGCACAGG - Intronic
1044783102 8:95763622-95763644 GCGCCTGCAGAGCCAAGAGCAGG + Intergenic
1045325724 8:101116367-101116389 GACCCTGGACAGCCAGGAGCAGG + Intergenic
1047807236 8:128373210-128373232 GCTGCTGGAGATGCAGGTGCTGG + Intergenic
1048867056 8:138769002-138769024 GGGGCTGGAGAGACAGGAGATGG - Intronic
1048982322 8:139709423-139709445 GCCTCTGCAGGGCCAGGAGTTGG + Intergenic
1049168148 8:141139798-141139820 GCTGCTGGGAAGGCAGGAGCAGG - Intronic
1049206509 8:141366157-141366179 GCGGCTGGAGAGCCGGGCGTGGG - Intronic
1049456418 8:142693310-142693332 TCTGCTGGGGAGCCTGGAGCCGG - Intergenic
1049472477 8:142782643-142782665 GCCACCGGAGAGCCGGGTGCCGG - Intergenic
1049531967 8:143159509-143159531 GCCGCGGGAGAGCCGGGTGTGGG - Intronic
1049612509 8:143562068-143562090 GCTGCTGGAGGGCCTGGAGGGGG + Exonic
1049620038 8:143593967-143593989 CCAGCAGGAGAGCCCGGAGCAGG + Intronic
1049683366 8:143929646-143929668 GCTGCTGCAGAGCCTGGAACAGG - Exonic
1049747663 8:144269847-144269869 GGCGCTGGTGAGTGAGGAGCAGG + Intronic
1049801741 8:144520923-144520945 CCCCCTGGAGAGCCTGGAGTTGG + Exonic
1049802250 8:144523278-144523300 GACTCTGGAGCGCCAGGCGCGGG + Exonic
1050337257 9:4601636-4601658 ATCGCTGGGGAGCCAGGACCTGG + Intronic
1053067353 9:35078074-35078096 GCAGCTGGAGAGAAAGGAGGAGG + Intronic
1053069382 9:35092122-35092144 GAAGCTGGACAACCAGGAGCAGG + Exonic
1055694248 9:78865909-78865931 GGCGCTGGAGAGGGTGGAGCAGG + Intergenic
1056122765 9:83505566-83505588 GCAGCTGTAGAGTCAGGAGGTGG - Intronic
1056272072 9:84955970-84955992 CACGCTGGAGTGCCAAGAGCAGG - Intronic
1057383004 9:94585520-94585542 GGGGCTGGAGAGCCATGAGGGGG + Intronic
1057466231 9:95317201-95317223 GCCCCCGGAGAGGCGGGAGCCGG - Intronic
1059426181 9:114222327-114222349 GCGTGTGGGGAGCCAGGAGCAGG + Intronic
1060975282 9:127761627-127761649 GCTGCTGGAGAGCCAGAGGCTGG - Exonic
1061062455 9:128257498-128257520 GCTGCTGGAGCTGCAGGAGCTGG - Exonic
1061203680 9:129151073-129151095 GCCGCTGGGGTGCCAGCAGCAGG - Intergenic
1061407917 9:130402942-130402964 GCAGGTGGAGAGCCAGAGGCAGG + Intronic
1061492830 9:130955798-130955820 CCCAGGGGAGAGCCAGGAGCTGG - Intergenic
1061582357 9:131545815-131545837 GCTGCTGGAGGGGCAGGTGCTGG + Intergenic
1061654664 9:132079694-132079716 GACGCTGGAGGGCCGGGAGAAGG - Exonic
1061912507 9:133732521-133732543 GCGGGTGGTGAGCCGGGAGCTGG - Exonic
1062085204 9:134644570-134644592 TCCACTGGAGAGGCAGGCGCGGG + Intronic
1062338059 9:136081195-136081217 GCCGCTGGAAACCCAGGGGAAGG + Intronic
1062726897 9:138079362-138079384 GCAGGTGGAGAACCAGGAGTGGG + Intronic
1203792770 EBV:160467-160489 GGGGCTGGAGAGCCTGGAACGGG - Intergenic
1203626832 Un_KI270750v1:33018-33040 GCGGCTGGAGAGGTAGGAGAAGG - Intergenic
1185474465 X:406173-406195 GCCGCTGAAGATCCAGAAGACGG - Intergenic
1185505455 X:630089-630111 GGCGCTGGAGACCCGGGAGGCGG + Intronic
1185932559 X:4219245-4219267 ACTGATGGAGTGCCAGGAGCTGG - Intergenic
1189065747 X:37806449-37806471 ACTGCTGGAGAGCCAGATGCAGG + Exonic
1189407127 X:40735379-40735401 GCAGCTGGAGAACCACCAGCTGG - Exonic
1190621423 X:52290296-52290318 CCTGCTTGAGTGCCAGGAGCAGG + Intergenic
1190893818 X:54596679-54596701 GCCACTGGGGAGCCAGGGACTGG + Intergenic
1191910428 X:66143842-66143864 GCCCCTGCAGACCCAGGATCTGG - Intergenic
1194379246 X:93174654-93174676 GCCTTTGGAGGGCCAAGAGCAGG + Intergenic
1199780639 X:151055872-151055894 GCCGCTGGAGAGGCTGAGGCAGG - Intergenic
1200058174 X:153472371-153472393 GTCGCTGAAGACCCAGCAGCAGG + Intronic
1200155441 X:153972427-153972449 GCCGCGGGGGAGCCGGGGGCGGG + Exonic