ID: 1006750025

View in Genome Browser
Species Human (GRCh38)
Location 6:36371352-36371374
Sequence GGCCTGCGGCATCGCGGGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 138}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006750010_1006750025 23 Left 1006750010 6:36371306-36371328 CCAGAGGAACAGCCTCCCACTCA 0: 1
1: 0
2: 1
3: 15
4: 194
Right 1006750025 6:36371352-36371374 GGCCTGCGGCATCGCGGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 138
1006750015_1006750025 0 Left 1006750015 6:36371329-36371351 CCAGCGATCCTGCCGTCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1006750025 6:36371352-36371374 GGCCTGCGGCATCGCGGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 138
1006750011_1006750025 11 Left 1006750011 6:36371318-36371340 CCTCCCACTCACCAGCGATCCTG 0: 1
1: 0
2: 1
3: 24
4: 327
Right 1006750025 6:36371352-36371374 GGCCTGCGGCATCGCGGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 138
1006750009_1006750025 29 Left 1006750009 6:36371300-36371322 CCATGGCCAGAGGAACAGCCTCC 0: 1
1: 0
2: 1
3: 40
4: 310
Right 1006750025 6:36371352-36371374 GGCCTGCGGCATCGCGGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 138
1006750013_1006750025 7 Left 1006750013 6:36371322-36371344 CCACTCACCAGCGATCCTGCCGT 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1006750025 6:36371352-36371374 GGCCTGCGGCATCGCGGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 138
1006750019_1006750025 -8 Left 1006750019 6:36371337-36371359 CCTGCCGTCAATGGGGGCCTGCG 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1006750025 6:36371352-36371374 GGCCTGCGGCATCGCGGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 138
1006750012_1006750025 8 Left 1006750012 6:36371321-36371343 CCCACTCACCAGCGATCCTGCCG 0: 1
1: 0
2: 0
3: 2
4: 113
Right 1006750025 6:36371352-36371374 GGCCTGCGGCATCGCGGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006750025 Original CRISPR GGCCTGCGGCATCGCGGGGA AGG Exonic
900090280 1:917268-917290 GGCCTGGGGCAACCCTGGGACGG - Intergenic
903375774 1:22864944-22864966 GGCCTCCGGAGTCGCGGGGAGGG - Exonic
904599034 1:31663856-31663878 GGCAAGCAGCATAGCGGGGAAGG + Intronic
907270549 1:53288448-53288470 GGCCTGCGGCATGGCTGGGGAGG + Intronic
910657394 1:89632942-89632964 GGCCTGCGTCACAGCGGGGCTGG + Intergenic
911188697 1:94927281-94927303 GGCCGGGGACCTCGCGGGGAGGG - Intergenic
912508861 1:110174906-110174928 GGCCTGGAGCATCGTGGGGATGG + Exonic
912554978 1:110509231-110509253 AGCCTGGGGCATAGCTGGGATGG - Intergenic
919840496 1:201605762-201605784 GGCCAGCTGCATCTAGGGGAGGG + Intergenic
923041413 1:230322582-230322604 GGCCTGTGGCAGGGCCGGGAAGG - Intronic
924502884 1:244653253-244653275 GGCCTCCGGCCCCGCGGAGACGG + Exonic
1063376090 10:5555332-5555354 GGGCTGGGGCATGGCAGGGAAGG - Intergenic
1068508036 10:57927845-57927867 GGCATGCTACATCGCGGGGGAGG - Intergenic
1069452283 10:68527310-68527332 CGCCTGCGGCATTGCGGGAGGGG + Exonic
1072665297 10:97388407-97388429 GGCCTGCGGTAGGGCGGGGCTGG - Intronic
1074065466 10:110008559-110008581 GGCCTGCGGCGCCGCCGGGTGGG + Intronic
1074755866 10:116623757-116623779 GGGCTGCGGCGTCGCGGGGTGGG - Intronic
1076187289 10:128459681-128459703 GGCCTGAGGCTTGGCAGGGAGGG - Intergenic
1076768396 10:132650148-132650170 GGTCTGAGGCATCCCAGGGATGG - Intronic
1076909336 10:133379373-133379395 GGGCGGCGGCATCGCGGGGCTGG + Exonic
1077214689 11:1390454-1390476 GGCCTGCGGCTTCGCGGCCGGGG - Intronic
1077249675 11:1555469-1555491 TGCCTGGGGCATGGCTGGGAGGG + Exonic
1077499852 11:2904383-2904405 CGCCTGAGGCACGGCGGGGAGGG - Intronic
1077505868 11:2929751-2929773 GGCGTGAGTCATCGCGGGCAGGG - Intergenic
1083271923 11:61577061-61577083 GGGCTGGGGCATAGTGGGGAGGG - Intronic
1083335603 11:61920008-61920030 GACCTGGGGCATGGAGGGGAGGG - Intronic
1083658315 11:64240956-64240978 GGGCAGCGGCGTCGCGGGGGCGG + Intergenic
1083890312 11:65592552-65592574 GGCCGGCGGCCTCGGGGAGAGGG + Exonic
1084149311 11:67280846-67280868 GGCCTGTGGCTTGGCTGGGAGGG + Intronic
1084325941 11:68400077-68400099 GGCCTGCGGAATCTCCTGGATGG - Intronic
1089338430 11:117741724-117741746 GGCCTGCAGCTTCATGGGGAGGG - Intronic
1090236123 11:125148674-125148696 GGCCTGCTGCAGAGCTGGGAGGG - Intergenic
1091295479 11:134471307-134471329 GGTGTGGGGCAGCGCGGGGAGGG - Intergenic
1091395718 12:153255-153277 GGCCTGTGTCATCCTGGGGAAGG - Intronic
1092218937 12:6700215-6700237 GGCCTGCGGGATGGGTGGGATGG - Exonic
1100831001 12:98516288-98516310 CGCCTGCAGCCCCGCGGGGAAGG - Intronic
1101781864 12:107844651-107844673 GCCCTGGGGCATGGCGGGCAGGG + Intergenic
1103735196 12:123056702-123056724 GGCCTGGGGCATCCCGGGAGAGG - Intronic
1104745008 12:131205014-131205036 GGACTGCAGCATGGCGGGGCCGG - Intergenic
1104841521 12:131828234-131828256 GGTCCGCGGCATCACAGGGAAGG - Intergenic
1104987248 12:132603981-132604003 AGCCTGCGGAGCCGCGGGGAGGG - Intronic
1114736595 14:25049516-25049538 GGCCCATGCCATCGCGGGGACGG + Intronic
1116917810 14:50542273-50542295 GGCCTGTGGTGTCGGGGGGAGGG + Intronic
1118538017 14:66790691-66790713 TGCCTGTGGCAGGGCGGGGAGGG + Intronic
1121339403 14:93096195-93096217 GGGCTGCGGCATCTCAGGCAGGG - Intronic
1121732161 14:96194449-96194471 GGCCTGCGGCAGCACGGGGCAGG + Intergenic
1122645162 14:103189238-103189260 GGGCTGCGGGGTCGAGGGGAGGG + Intergenic
1124500738 15:30225071-30225093 GGCCTGCTGCAGCGTGGCGATGG - Intergenic
1124631015 15:31337180-31337202 GGCCTGCGGCAGGGCAGGCAGGG + Intronic
1124742831 15:32313596-32313618 GGCCTGCTGCAGCGTGGCGATGG + Intergenic
1126100298 15:45114641-45114663 AGCCTGCGGCATGCCGGGGCTGG - Exonic
1129596996 15:76973225-76973247 GGCCTGGGGCAGGGCGGGGCAGG + Intergenic
1130945335 15:88546611-88546633 GTCCTGGGGCATGGCGGGGGCGG - Exonic
1131071686 15:89470196-89470218 GGGGTGCGGCGTGGCGGGGAGGG - Intergenic
1132056122 15:98650691-98650713 GGTCTGCGGCGGCGCGGGGAGGG + Intronic
1132728707 16:1350121-1350143 GGCCTGCGGCAGCCCGGAGGAGG - Exonic
1133318352 16:4897845-4897867 GGGCTGGGGCATGGCGGGGGAGG + Intronic
1135976480 16:27111690-27111712 GCCCTGCAGCATCTCAGGGAAGG + Intergenic
1136612922 16:31378147-31378169 GGCCTGGGGCTTGGAGGGGAGGG - Intronic
1139806177 16:69566570-69566592 GGCCGGCGGCTCCGCGGGGGAGG - Intronic
1141910889 16:87057673-87057695 GGCCTGCGGCCATGCGGGGCGGG - Intergenic
1142233388 16:88910255-88910277 GGGCTGCAGCATCACCGGGAAGG - Intronic
1142280753 16:89146433-89146455 TGCCTGTGGCCTGGCGGGGAAGG - Intronic
1143327356 17:6108134-6108156 GGCCTGGGGCATTGGCGGGAGGG - Intronic
1147123743 17:38352042-38352064 GGCCTCCTGCATCGGGGAGAGGG - Intergenic
1147567417 17:41546262-41546284 TGCCTGTGGCATGGCGGGGCTGG - Intergenic
1150003211 17:61454847-61454869 GGCCTGCGGGGTCGCAAGGAGGG - Intronic
1152623691 17:81378965-81378987 GGCCTGCTGCACCCTGGGGAGGG - Intergenic
1152811817 17:82385993-82386015 GGCCTGGGGCCTGACGGGGAGGG + Intergenic
1154379604 18:13837428-13837450 GGCCTGCAGCACCGCAGAGACGG - Intergenic
1156339868 18:36201153-36201175 GGCCTGGGGCATAGACGGGAAGG + Intronic
1158437096 18:57441430-57441452 GGGCTGGGGCCTCGCGGGGGAGG - Intronic
1162750348 19:12825770-12825792 GGGCTGCGGGAACGCCGGGAGGG + Exonic
1163598245 19:18232909-18232931 GGCCTCCTGCAGCGCGGGGGAGG - Intronic
1165346767 19:35253526-35253548 GGCATGGGGCAGAGCGGGGAAGG + Intronic
1167356429 19:49007009-49007031 GGCCTGCGCCATGCCTGGGAAGG - Exonic
1168339415 19:55614839-55614861 GCCCTGCGGCATCTGCGGGAAGG + Exonic
925742520 2:7018416-7018438 TGTCGGAGGCATCGCGGGGACGG + Intronic
927131064 2:20061233-20061255 GGCGGGGGGCATTGCGGGGAGGG - Intergenic
927653826 2:24928820-24928842 GGCCTGCAGCCTGGCCGGGAAGG + Intergenic
927685569 2:25168424-25168446 GGCCGACTGCATCGCGAGGACGG + Intronic
931224538 2:60318629-60318651 AGCCTGCAGCAGGGCGGGGAGGG - Intergenic
933614407 2:84469562-84469584 TGCCTGTGGCAGCGTGGGGAAGG + Intergenic
936075274 2:109397740-109397762 GGGCTGCGGCATCACCTGGAGGG - Intronic
937420991 2:121755428-121755450 GGCCTGAGGGAGGGCGGGGACGG - Intronic
945465935 2:210171072-210171094 GGACGGCGGCAGCGCGGGGAGGG - Intronic
946403934 2:219483138-219483160 GGCCCGCAGCAGCTCGGGGATGG - Exonic
947748894 2:232522824-232522846 CGCCTGCGCCATCGCGGGCTGGG + Exonic
948728244 2:239947600-239947622 GGCCTGGGGCTCGGCGGGGAGGG - Intronic
1170889101 20:20364300-20364322 GTCGTGCGTCCTCGCGGGGAGGG - Intergenic
1174251010 20:49219584-49219606 GACCTGAGGAATCGCGAGGAAGG - Intronic
1175340891 20:58228453-58228475 GGCCAGGGGCTGCGCGGGGAGGG + Exonic
1175997830 20:62819308-62819330 GGAGTGGGGCATGGCGGGGAGGG - Intronic
1181433954 22:22899569-22899591 GGGCTGGGGCATCCCAGGGAGGG + Intergenic
1183063736 22:35350100-35350122 GGCCGGGGGCATGGAGGGGAGGG + Intergenic
1183931315 22:41237679-41237701 GCACTGCGGCATCGCGGAGCTGG - Exonic
1184110061 22:42389246-42389268 GGCCTGCAGCATCCCAGGGCAGG - Intronic
1184517715 22:44972956-44972978 GACCTCCTGCATGGCGGGGAGGG - Intronic
1184684895 22:46091800-46091822 GGCCCGAGGCAGCTCGGGGAAGG + Intronic
1185279102 22:49962350-49962372 TGCCTGCGGGAACGGGGGGAGGG - Intronic
950650303 3:14402909-14402931 GGACTGCGGCGACGCGGGGATGG - Intronic
950660999 3:14466993-14467015 GGGCTGCTGCATCCTGGGGATGG + Intronic
952388370 3:32859665-32859687 GGCCAGCGGCATTCCGGGCAGGG - Intronic
955927635 3:64023408-64023430 CTCCAGCGGCATCGCGGCGAAGG + Exonic
956833138 3:73073162-73073184 GGCCTGGGGCATGGGGGAGAGGG - Intergenic
967903978 3:194486432-194486454 GGAGTTGGGCATCGCGGGGACGG - Intronic
968732476 4:2276132-2276154 GGGCTGCGGCAGAGCGGGGGAGG + Intronic
968972968 4:3805685-3805707 GTCCTGGGGCATCGCAGGGAAGG - Intergenic
969544776 4:7818561-7818583 GGCCTGCGGCGTCACAGTGATGG + Intronic
969551048 4:7867385-7867407 AGCCTGAGGCAGCGCGGGGGCGG + Intronic
970194955 4:13543924-13543946 CTGCTGCGGCTTCGCGGGGATGG - Intronic
970583665 4:17495180-17495202 GGACTGTGGCATGACGGGGATGG + Intronic
971352218 4:25863997-25864019 GTTCTGCGGCCTGGCGGGGAGGG + Intronic
977589798 4:98813660-98813682 GGCCTGCAGCAGGGTGGGGAAGG - Intergenic
980988019 4:139714736-139714758 TGCCTGTGGCAGGGCGGGGAAGG + Intronic
985528225 5:418587-418609 GGCCTGCGGCTGCTCAGGGAGGG + Intronic
985688625 5:1294978-1295000 AGCGCGCGGCATCGCGGGGGTGG + Exonic
985747004 5:1653379-1653401 GGCCAGCCGCTTCCCGGGGACGG - Intergenic
997391420 5:133520292-133520314 GGCCTGCAGCATGGAAGGGAAGG - Intronic
1006043279 6:31271926-31271948 GTCCTGCGCCCTCGCCGGGAGGG + Intronic
1006402263 6:33824793-33824815 GGCTTCGGGCAGCGCGGGGAAGG + Intergenic
1006750025 6:36371352-36371374 GGCCTGCGGCATCGCGGGGAAGG + Exonic
1007904499 6:45445508-45445530 GGCCTGCAGCATCTGGGGCATGG - Intronic
1008561381 6:52728110-52728132 GGCCTGAGGGATAGCAGGGAGGG + Intergenic
1013619233 6:111872741-111872763 GCCCCGAGGCAGCGCGGGGATGG - Intronic
1015377352 6:132526213-132526235 TGCCTGCGGCAGGGTGGGGAAGG - Intergenic
1017919290 6:158857458-158857480 GACCTGCGGCATCGTGAGGAAGG - Intergenic
1019195077 6:170276525-170276547 GGCCTGCGGTGTCGCGGGGGTGG - Intergenic
1019564404 7:1672259-1672281 GTCCTGGGGCATGGTGGGGAAGG - Intergenic
1019989475 7:4682014-4682036 CGCCTGCAGCCCCGCGGGGAGGG + Intergenic
1020107263 7:5427933-5427955 GGCCTGTCGCAGCGAGGGGACGG - Intergenic
1020347785 7:7183231-7183253 GGTCTGCGGCGGGGCGGGGAGGG - Intronic
1022973484 7:35537298-35537320 GGCCCGCGGCAGGGCGGGGCGGG + Intergenic
1026297117 7:69062730-69062752 GCCCTGCCCCCTCGCGGGGATGG - Intergenic
1026360491 7:69598217-69598239 GGCCGGCGGGATCACGTGGACGG - Intergenic
1027228881 7:76260970-76260992 GGCCTCCGGCCTCTGGGGGATGG - Intronic
1034268455 7:149792190-149792212 GCCCTGCGGCAGCCCGGGTAAGG + Intergenic
1042591356 8:70402419-70402441 GGCCTGCGGGACCGAGGGGCGGG - Intronic
1045111887 8:98944432-98944454 GGCCTGGGGCAGCCTGGGGAGGG + Exonic
1047951489 8:129939439-129939461 GGCCCGGGGCGTCGCGGGGCCGG + Intronic
1049330422 8:142047539-142047561 GGCCTTCGGCATTGGGGGCAGGG - Intergenic
1049394865 8:142395308-142395330 GGCCTGGTGCCTCCCGGGGAGGG - Intronic
1049614819 8:143571530-143571552 GGCATGAGTCATCGCGGGGCTGG + Intronic
1053364922 9:37516034-37516056 GGCCTACGGCATCGCCGTGCGGG - Exonic
1061597495 9:131641345-131641367 GGCCTGGTGTATCCCGGGGAGGG - Intronic
1062081549 9:134626685-134626707 GGCCTGCCACATCACTGGGAGGG + Intergenic
1062081571 9:134626766-134626788 GGCCTGCCACATCACCGGGAGGG + Intergenic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1062272220 9:135714755-135714777 GGCGTGCGGCGGCGCCGGGACGG - Intronic
1199445102 X:147912037-147912059 GGCGTGCGGCAGCGCGGCGGCGG + Exonic
1200000344 X:153056746-153056768 GTCCTGGGGCAGCGCGGGGAGGG + Intronic
1200099680 X:153684450-153684472 GGCCTGCAGCAGGGCAGGGATGG - Intronic