ID: 1006752567

View in Genome Browser
Species Human (GRCh38)
Location 6:36387816-36387838
Sequence CGCCGCTGCGGGCTAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006752558_1006752567 22 Left 1006752558 6:36387771-36387793 CCTTCCGGGAAACGAAAACGAAA 0: 1
1: 0
2: 0
3: 5
4: 172
Right 1006752567 6:36387816-36387838 CGCCGCTGCGGGCTAGGAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 111
1006752559_1006752567 18 Left 1006752559 6:36387775-36387797 CCGGGAAACGAAAACGAAAGAGC 0: 1
1: 0
2: 1
3: 12
4: 128
Right 1006752567 6:36387816-36387838 CGCCGCTGCGGGCTAGGAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006752567 Original CRISPR CGCCGCTGCGGGCTAGGAGC AGG Intergenic
901109607 1:6784845-6784867 CGCCGCTGCCGGTGGGGAGCCGG - Intergenic
903668541 1:25022325-25022347 CCCTGCTGTGGGCGAGGAGCAGG + Intergenic
904751144 1:32741978-32742000 CGCACCTGCGGCCGAGGAGCCGG + Exonic
908009339 1:59759563-59759585 CTCCGCTGCTTGCTGGGAGCTGG + Intronic
909608603 1:77531324-77531346 TGCCACTGCAGGCTAGGATCTGG + Intronic
915724518 1:158008137-158008159 CCTCGCTGCCGGCTAGGAGCAGG - Intronic
918303118 1:183221881-183221903 AGCAGCTGCGGGATGGGAGCAGG + Intronic
921189822 1:212699602-212699624 CGCCGCGGGGGGCGAGGAGGTGG - Intronic
922416579 1:225427911-225427933 CGCCGCGGGGAGCTGGGAGCAGG + Intronic
1062947821 10:1474455-1474477 CTCTTCTGCGGGCTAGGAGGAGG + Intronic
1067140015 10:43648830-43648852 CGCTGCTGCGGGCTCGGCGCCGG - Intronic
1071086562 10:81874305-81874327 CGCCGCGGCGGGCTGGGATTCGG - Intergenic
1071086633 10:81874549-81874571 CGCCGCCGCGAGCCAGGGGCTGG - Intergenic
1072701010 10:97641198-97641220 CGCCGCCGCGGGCTGAGGGCCGG + Intronic
1074705102 10:116123228-116123250 CTTAGCTGTGGGCTAGGAGCAGG - Intronic
1075801766 10:125159155-125159177 CGCCGCGGAGGGCTGGGAGGAGG + Intronic
1076247086 10:128955718-128955740 AGCCCCTGGGGGCTAGGAGTTGG + Intergenic
1077047990 11:554675-554697 GGCCACTGCGGCCTAGGAGGTGG - Exonic
1077356279 11:2120396-2120418 GGCCGCTGAGGGCTGGGTGCTGG + Intergenic
1083849198 11:65355350-65355372 CGCCGCTGGGGGGTGGGAGGTGG - Intronic
1084312445 11:68324896-68324918 CGCCACTGGGTGCTAGGCGCTGG + Intronic
1084452933 11:69250803-69250825 GGCTGCTGCGGACGAGGAGCTGG + Intergenic
1084658211 11:70531649-70531671 CGCCTCTGCGTCCTAGGAGTGGG + Intronic
1085332819 11:75667724-75667746 CGCCGCTGAGGCCCGGGAGCAGG - Exonic
1089492728 11:118893955-118893977 CGGCGATGCAGGCCAGGAGCAGG - Exonic
1091799156 12:3313845-3313867 CACCACTGCTGGCAAGGAGCAGG - Intergenic
1092193200 12:6534650-6534672 CGCCGCTGCGGGGTGGGCCCGGG + Intronic
1092462316 12:8697736-8697758 CTCGGGTGCGGGCGAGGAGCTGG + Intronic
1096482473 12:51951788-51951810 CGCCGCTGCCGGCGAGCAGGAGG - Exonic
1096842146 12:54385919-54385941 CACAGCTGGGGGCTGGGAGCTGG + Intronic
1103954290 12:124567697-124567719 CGTCGCTGCGGGCGGGGAGCCGG - Intergenic
1105745723 13:23375522-23375544 AGCCGCGGCGGCCGAGGAGCAGG + Intronic
1115592210 14:34874959-34874981 GGCGGCGGCGGGCGAGGAGCCGG - Intronic
1117963912 14:61188314-61188336 GGTAGCTGCGGGCTAGGAGGAGG + Intronic
1122131183 14:99605082-99605104 CGCCGCTCCGGGCAGGGGGCAGG - Intergenic
1123491205 15:20783956-20783978 CACCGCTGCGCGCCATGAGCAGG - Intergenic
1123547707 15:21353047-21353069 CACCGCTGCGCGCCATGAGCAGG - Intergenic
1128145503 15:65330484-65330506 CGGCGCTGAGGGCCAGGAGGTGG - Intronic
1129956052 15:79637774-79637796 AGCCGCTGCTTGCCAGGAGCTGG - Intergenic
1131515010 15:93071582-93071604 TGGCGCTGGGGGCCAGGAGCAGG + Intronic
1202956037 15_KI270727v1_random:80277-80299 CACCGCTGCGCGCCATGAGCAGG - Intergenic
1132734770 16:1379817-1379839 CGCGGCTCCTGGCTACGAGCTGG + Intronic
1134121132 16:11586135-11586157 CGCCGGTGCTGGGTAGGTGCTGG - Intronic
1140748330 16:78000601-78000623 TGCCGCTGCTGGCTAGGAGATGG - Intergenic
1142687441 17:1585868-1585890 AGGGGCTGCGGGCTGGGAGCCGG + Intronic
1148607993 17:48944709-48944731 CACCGCCGCGGGGTGGGAGCTGG - Exonic
1152049144 17:77958956-77958978 CGCCGCCGCCGCCTAGGACCCGG + Intergenic
1160225605 18:77008751-77008773 CACCGCCGCGGGCCAGGAGTAGG - Intronic
1160383386 18:78477983-78478005 CGCAGCTGGGGGCAAGGAACGGG - Intergenic
1160413299 18:78689073-78689095 CGGAGCTGGGGGCTTGGAGCTGG - Intergenic
1160753269 19:745253-745275 CCCCGATGCGGGGAAGGAGCAGG + Intronic
1160909250 19:1467300-1467322 CGGCGCCGCGGACCAGGAGCTGG + Exonic
1161461540 19:4400486-4400508 CGCCGGGGCGGGCGCGGAGCTGG - Exonic
1162396404 19:10420336-10420358 CCCCGCTCCGGGCTGGGAGGGGG - Intronic
1163714643 19:18866688-18866710 CGCCGCCGCGGGCCAGCAGGGGG - Exonic
926006614 2:9377918-9377940 CCCTGCTGCGTTCTAGGAGCCGG - Intronic
926784613 2:16507819-16507841 CGCCGCTGCTGGGCATGAGCAGG + Intergenic
929776854 2:44935413-44935435 CGCAGCTCCGCGCTAGGATCGGG + Intergenic
933655245 2:84881223-84881245 CTCCGCTGCCGCCTAGGCGCGGG - Exonic
938414623 2:131093764-131093786 CGCCACTACGGGGTCGGAGCGGG + Intergenic
938639785 2:133266531-133266553 TGCTGCTGCGGGCTGGGGGCGGG + Intronic
939863901 2:147451122-147451144 CACAGCTGCTGGCTAGGAGAAGG + Intergenic
942218986 2:173750692-173750714 CGTGGCTGCAGGCTGGGAGCAGG - Intergenic
942277849 2:174335923-174335945 CGCCGCACCGGGCGCGGAGCAGG - Intronic
947846925 2:233251951-233251973 CGCCGGTGCGGGCTGGGAGTGGG + Intronic
1171372968 20:24673525-24673547 CTCCGCTGTGGGCGAGGACCAGG + Intergenic
1173227051 20:41168189-41168211 GGCAGCAGCGGGGTAGGAGCTGG + Intronic
1173279754 20:41618017-41618039 CGCCGCTGCGGGCCGCGCGCAGG - Intronic
1173582999 20:44160403-44160425 CGTCCCTGCGGGCGAGGAGAGGG + Exonic
1173727372 20:45307159-45307181 CGCGGCGGTGGGGTAGGAGCTGG - Intronic
1174315480 20:49697282-49697304 CGCCGCTGCGCTTGAGGAGCAGG - Intronic
1175913189 20:62414244-62414266 AGCAGCTGCGGGCTAGGGCCAGG - Exonic
1176128533 20:63486728-63486750 CCCGGCTGCAGGCTGGGAGCTGG + Intergenic
1176178787 20:63740215-63740237 CGCCGCGCCGGGCTGGGGGCGGG + Intronic
1176247192 20:64102834-64102856 CTCTGCCGCGGGCTTGGAGCGGG + Intergenic
1178535054 21:33403841-33403863 CCCCGCTGCGGGCTCCCAGCGGG - Intronic
1183607323 22:38873122-38873144 CGCAGCTGCGGGCGGGGAGAGGG - Intergenic
1184662621 22:45972338-45972360 CGGCGCTGGGCGCTAGGGGCCGG + Intronic
1185055257 22:48575853-48575875 CGCCGCGGCGGGCCAGGCTCGGG - Intronic
951217729 3:20040505-20040527 GGCGGCTGCGGGGCAGGAGCCGG + Exonic
960161178 3:114351704-114351726 CACCGCTGCGTGCTGGCAGCCGG - Exonic
960966719 3:123110751-123110773 AGCCGCGGCAGGCCAGGAGCTGG - Intronic
961403006 3:126660382-126660404 CCCCACTGCTGGCCAGGAGCAGG - Intergenic
964790512 3:160450013-160450035 CGCGCCTGCGTGCTAGGCGCAGG + Intronic
967904099 3:194486789-194486811 CGCCGCCGCGGGCGCGGAGGAGG - Intronic
968820134 4:2843918-2843940 CGCTGCTGCGGGCCAGGGGACGG + Exonic
969674669 4:8608143-8608165 CGCAGCTGGGGGCTGGGGGCTGG - Intronic
971257904 4:25030796-25030818 CGCCGCTGCTGGCGAGGACTAGG + Exonic
971457931 4:26861319-26861341 CGCCGCGGCGGGAGAGGAGGCGG - Exonic
976751904 4:88457497-88457519 CGCCGCTCCCGGCGAGCAGCTGG - Exonic
980130015 4:128809785-128809807 GGCCGCGGCGGGCGGGGAGCCGG - Exonic
981093479 4:140756344-140756366 CGCCGCCGTGGGCCGGGAGCCGG - Intergenic
990527345 5:56640964-56640986 CACCACTCAGGGCTAGGAGCAGG + Intergenic
1002045171 5:176537389-176537411 GGCCCCTGCGGGCTTGCAGCGGG - Exonic
1004114223 6:12750215-12750237 CGCCGCTGCGGTGTTGGAGTGGG + Intronic
1004208489 6:13614731-13614753 CGTCGCTGCGGCCGCGGAGCTGG + Intronic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1005688741 6:28281538-28281560 CTCCGCTGCGGGCGCGGCGCAGG + Exonic
1006752567 6:36387816-36387838 CGCCGCTGCGGGCTAGGAGCAGG + Intergenic
1007558105 6:42783143-42783165 CGCCGCCGCGGGCTCGGAGCGGG - Intronic
1017889109 6:158624769-158624791 CGCCCCTGGGGGCGAGGGGCTGG - Intronic
1018331037 6:162727684-162727706 GGCGGCTGCGGGCCAGGAACAGG + Exonic
1029715152 7:102321620-102321642 CGGCGCCGCGGGCTAGTAGAAGG - Exonic
1032021554 7:128409656-128409678 CGACGCTGCGGGGGAGGGGCAGG - Intronic
1034560619 7:151877316-151877338 CGCGGCGGGGGGCGAGGAGCGGG - Intergenic
1035169531 7:157009933-157009955 CGCCGCTGGGGGCCTGGCGCTGG - Exonic
1036753549 8:11457543-11457565 AGCCCCTGCCTGCTAGGAGCTGG - Intronic
1036788657 8:11703850-11703872 CGCAGCGGCGGGCGAGGGGCGGG - Intronic
1048980795 8:139702623-139702645 CGCCGCGCCGGGCTGGGTGCAGG - Intronic
1049694065 8:143975099-143975121 TCCCGCTGCGTGCTAGGCGCTGG - Intronic
1055090987 9:72364796-72364818 CGCCGCCGCGGGCCGGGAGCGGG + Intronic
1057023223 9:91717169-91717191 TGCCGCTGCTGGCTAGGAGATGG - Intronic
1057310472 9:93939941-93939963 TGCCGCTGCTGGCTGGGAGGTGG - Intergenic
1057334087 9:94142286-94142308 AGCCGCTGTGGCCTGGGAGCTGG + Intergenic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1185778768 X:2828723-2828745 GGCCGCGGCGGGCGAGGGGCGGG + Intergenic
1186220534 X:7344748-7344770 AGCCGCTGTGGGTTAGAAGCAGG + Intronic
1187737743 X:22321988-22322010 CACAACTGGGGGCTAGGAGCAGG + Intergenic