ID: 1006755985

View in Genome Browser
Species Human (GRCh38)
Location 6:36415961-36415983
Sequence TTGTATATGAAACAGGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006755982_1006755985 -6 Left 1006755982 6:36415944-36415966 CCCTGAAGACATCAATTTTGTAT 0: 1
1: 1
2: 4
3: 35
4: 377
Right 1006755985 6:36415961-36415983 TTGTATATGAAACAGGAGACTGG No data
1006755981_1006755985 -5 Left 1006755981 6:36415943-36415965 CCCCTGAAGACATCAATTTTGTA 0: 1
1: 0
2: 0
3: 18
4: 225
Right 1006755985 6:36415961-36415983 TTGTATATGAAACAGGAGACTGG No data
1006755983_1006755985 -7 Left 1006755983 6:36415945-36415967 CCTGAAGACATCAATTTTGTATA 0: 1
1: 0
2: 1
3: 21
4: 236
Right 1006755985 6:36415961-36415983 TTGTATATGAAACAGGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006755985 Original CRISPR TTGTATATGAAACAGGAGAC TGG Intronic
No off target data available for this crispr