ID: 1006763178

View in Genome Browser
Species Human (GRCh38)
Location 6:36481729-36481751
Sequence TATTCCTCCCCCATTGGTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006763178_1006763182 -1 Left 1006763178 6:36481729-36481751 CCTCCACCAATGGGGGAGGAATA 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1006763182 6:36481751-36481773 ATTCCCAAAGTAGGAGCTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 148
1006763178_1006763181 -10 Left 1006763178 6:36481729-36481751 CCTCCACCAATGGGGGAGGAATA 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1006763181 6:36481742-36481764 GGGAGGAATATTCCCAAAGTAGG 0: 1
1: 0
2: 0
3: 12
4: 132
1006763178_1006763185 4 Left 1006763178 6:36481729-36481751 CCTCCACCAATGGGGGAGGAATA 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1006763185 6:36481756-36481778 CAAAGTAGGAGCTTCTGGCATGG 0: 1
1: 0
2: 1
3: 15
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006763178 Original CRISPR TATTCCTCCCCCATTGGTGG AGG (reversed) Exonic
904440861 1:30529443-30529465 TGTTCCTCCACCATTTGTTGAGG + Intergenic
904964950 1:34364673-34364695 TATTCCTCTCACAAAGGTGGAGG + Intergenic
905466508 1:38158284-38158306 TTTTCCTCCTCCATGGGAGGAGG - Intergenic
908161452 1:61412390-61412412 TATTGCTCCCACGTTGGTGCAGG - Intronic
909119052 1:71577194-71577216 TATTCCTGCCTTTTTGGTGGAGG + Intronic
910289503 1:85586901-85586923 TGTTGCTCCCCCATTAATGGGGG + Intergenic
913287283 1:117238192-117238214 AGTTCCTCCCACATTGGTTGAGG + Intergenic
919922444 1:202174543-202174565 CATCCCTCCCCCACTGGTGGGGG - Intergenic
920035642 1:203063710-203063732 CCTTCCTCCCTCATGGGTGGAGG + Intronic
920613536 1:207466576-207466598 TATTCTACCCCCATTGCTGTTGG + Exonic
922763503 1:228146295-228146317 TCTTCCTCCCACCTTGGAGGCGG + Intronic
923473392 1:234312032-234312054 TATTCCTTCTCAATTGGAGGGGG + Intronic
1062900917 10:1146252-1146274 TATTCCTCCCTCATTCCTGAGGG + Intergenic
1063376737 10:5558544-5558566 GACTCCTTCCCCAGTGGTGGAGG - Intergenic
1064606579 10:17048019-17048041 TATTCTTCACCCCGTGGTGGAGG - Intronic
1067661357 10:48238245-48238267 TATAACTCCCCCATAGGTGGGGG - Intronic
1071034453 10:81226678-81226700 TTTTCCTTTCCCTTTGGTGGGGG - Intergenic
1074377582 10:112951932-112951954 TCCCCCTCCCCCTTTGGTGGTGG + Intronic
1076300677 10:129424086-129424108 TATTTTTCCCCCACTGGTGATGG - Intergenic
1076509753 10:131004452-131004474 AATTCCTGGCCTATTGGTGGTGG + Intergenic
1078675211 11:13405667-13405689 TATTCTTCTCCCATCTGTGGTGG + Exonic
1081447906 11:43148046-43148068 TATTCCTCCCCATATGGCGGGGG - Intergenic
1081448169 11:43149590-43149612 TATTACTCCCCATTTGGTGGGGG - Intergenic
1081825661 11:46048940-46048962 TATTCCTCAGACATTGCTGGTGG - Intronic
1083708305 11:64531611-64531633 TCTTCCTCCTACCTTGGTGGAGG - Intergenic
1083804407 11:65065719-65065741 TTTTGCAACCCCATTGGTGGAGG + Intergenic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1089146437 11:116332660-116332682 TTTTCCTCTCCCACTGGGGGAGG + Intergenic
1091058979 11:132444238-132444260 TTTGCCTCCCCCATGGGAGGCGG - Intronic
1091217895 11:133914691-133914713 TTTTCCTCCCACATTGGGTGAGG - Intronic
1097433428 12:59533416-59533438 TATTACTCCCCCTATCGTGGGGG + Intergenic
1101929945 12:109005778-109005800 TACTCCTCCCCTATTTGTGTGGG - Intronic
1106169430 13:27276010-27276032 TATGCCCTCCCCATTGGTGAGGG - Intergenic
1107545298 13:41428476-41428498 TATTACTCCCCGAATCGTGGAGG + Intergenic
1108464411 13:50700489-50700511 AATTCCACCACCATGGGTGGTGG + Intronic
1110217087 13:73035042-73035064 CATTCCTCCCCCATCCCTGGAGG + Intergenic
1114437097 14:22715257-22715279 TATTACTCCCCATATGGTGGGGG + Intergenic
1114437189 14:22715564-22715586 TATTACTCCCCATATGGTGGAGG + Intergenic
1114437211 14:22715641-22715663 TATTACTCCCCATATGGTGGGGG + Intergenic
1121865123 14:97355741-97355763 TATACCTACCCCACTGGTAGAGG - Intergenic
1122942368 14:104987136-104987158 TGTCCATTCCCCATTGGTGGGGG + Intronic
1125765463 15:42132421-42132443 TATTGCTGCCACACTGGTGGGGG - Intergenic
1128074682 15:64818759-64818781 GATTCCTCCCTCAATGTTGGGGG - Intronic
1131898533 15:97061597-97061619 GATCACTCCCCCATTGGAGGAGG + Intergenic
1136615411 16:31395435-31395457 CATTGCTCCCACATGGGTGGGGG - Intronic
1138943595 16:61820577-61820599 TTTTTCTCCCCCTTTGGTTGAGG + Intronic
1139458370 16:67102505-67102527 TATTCCTCCCCCTTTGAGTGTGG - Intergenic
1140142056 16:72267430-72267452 CTTTCCTCTCCCATTGGTGATGG + Intergenic
1141205887 16:81932830-81932852 GGTTCCTCCCCCATGGCTGGTGG - Intronic
1143266281 17:5640337-5640359 AATTCCTCACACAATGGTGGAGG + Intergenic
1143407225 17:6685592-6685614 GATTCCTCATCCTTTGGTGGTGG + Exonic
1144636943 17:16916135-16916157 GCTTCCTCCAGCATTGGTGGAGG + Intergenic
1147486761 17:40822530-40822552 TCTTCCTCCCGCAGTGGAGGAGG - Exonic
1147562697 17:41518781-41518803 TCTTCCTCCACCTTTGGGGGTGG - Exonic
1152369950 17:79880621-79880643 TATTCATACCCCACTGGTGGAGG - Intergenic
1152741050 17:82018480-82018502 TATTCCTACCCCAGGGGTTGGGG - Intergenic
1153663900 18:7351118-7351140 TATTCCTCTCTCTTTGGTGGAGG - Intergenic
1154503424 18:15008155-15008177 GATTCCTCCAGCATTGCTGGTGG + Intergenic
1156859507 18:41819241-41819263 TTATCCTCCCCCACTGATGGAGG - Intergenic
1158566904 18:58561726-58561748 ACTCCCACCCCCATTGGTGGAGG + Intronic
1160300584 18:77674242-77674264 TATTTCCTCACCATTGGTGGAGG + Intergenic
1161044307 19:2126928-2126950 TCTTCCACCGCCATTGGTGCTGG - Intronic
1161337508 19:3722339-3722361 TGTTCATCCCCCTTTGCTGGGGG + Intronic
1163329632 19:16628129-16628151 TCCTCCTCCTCCTTTGGTGGCGG - Exonic
1166577450 19:43855664-43855686 CATCCCTGCCCCATTGGTGTTGG - Intergenic
1168444009 19:56396161-56396183 TACTCCTCCACCACTTGTGGAGG - Intergenic
926273836 2:11388604-11388626 TATACCTTCCCCATTGGATGTGG - Intergenic
926872802 2:17441501-17441523 GATTCCTCCCCCACCTGTGGAGG + Intergenic
927309102 2:21608327-21608349 TATTCCGTCCCCAATGGTTGTGG + Intergenic
928325396 2:30315556-30315578 TATTTCTCCCCCTTTGGCTGAGG - Intronic
929492230 2:42407405-42407427 TGTTCCTCCCACCTTGGTGATGG + Intronic
930167503 2:48217727-48217749 TGTTCCTCCTCTATTGGTGATGG - Intergenic
937378494 2:121354409-121354431 TCTTCCTCCTCCATTTGTGCAGG + Intronic
938502594 2:131838286-131838308 GATTCCTCCACCATTGCTGGTGG + Intergenic
946338622 2:219054879-219054901 TCTGCCTCCCCCATTGGGGAGGG - Exonic
947809007 2:232988177-232988199 CCCTCCTCCCCCAGTGGTGGGGG - Intronic
947939496 2:234037274-234037296 TATTTCTCCCTCATTTGTGAAGG - Intergenic
1175705368 20:61172655-61172677 TCTTCCTATCCCATTGCTGGAGG + Intergenic
1175826891 20:61941292-61941314 GACTCCTCCCCCTGTGGTGGGGG + Intergenic
1178693742 21:34774578-34774600 TATTCCACCACCATCGATGGAGG + Intergenic
1183160584 22:36110489-36110511 TATTCCTCCCCCAGTGGCTGGGG + Intergenic
1184055590 22:42045988-42046010 TATTCCACCCACCCTGGTGGAGG - Intronic
951800984 3:26595862-26595884 TATTCCTCACCCCTTGGGAGAGG - Intergenic
953488728 3:43328571-43328593 TATTCCTCCACAAATGGGGGTGG - Intronic
954781259 3:53063083-53063105 TATTCCACCCACCCTGGTGGAGG + Intronic
962420769 3:135226660-135226682 TATTCCTCCCCCAGGTGTAGGGG - Intronic
967218729 3:187231438-187231460 TCTTCCTCCCCCTTTGGAGCCGG + Intronic
967637150 3:191816079-191816101 TTTTGCTAACCCATTGGTGGTGG - Intergenic
968108555 3:196022397-196022419 TACTCCTCCACCTTTTGTGGAGG + Intergenic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
971188040 4:24400071-24400093 GATTCCTCCCCCAGGTGTGGTGG - Intergenic
971841564 4:31858989-31859011 TATTCCACCTGCAGTGGTGGAGG + Intergenic
976073389 4:81269121-81269143 TATTTCTCCCTCATTTGTGAAGG + Intergenic
978439370 4:108717389-108717411 ACTTACTCCCCCATTGGTTGAGG - Intergenic
984737848 4:183127646-183127668 TATTCCCCCCTTTTTGGTGGGGG - Intronic
986711698 5:10492650-10492672 CATGCCTCCCACATGGGTGGGGG - Intergenic
988642176 5:33051791-33051813 TATTCCTCCTTCATTTCTGGAGG - Intergenic
996241086 5:121202733-121202755 TATTCTTCTCACATTGCTGGAGG - Intergenic
997454994 5:134010138-134010160 TATTCCACCCCCCTTGATGCTGG + Intergenic
997686085 5:135788786-135788808 TATTACTCCCCGTGTGGTGGTGG + Intergenic
1001899455 5:175413254-175413276 TATTTCTACCCCATTGATGTTGG + Intergenic
1002126499 5:177049360-177049382 CAGTCCTCCACCACTGGTGGGGG + Intronic
1002766308 6:241799-241821 TATTCCTCCTCCATTGCTCAGGG - Intergenic
1003429133 6:6022804-6022826 CATTCCTGGCCCATTGGAGGTGG + Intergenic
1003436275 6:6091303-6091325 TATTCACCCCCCTTTAGTGGGGG - Intergenic
1006763178 6:36481729-36481751 TATTCCTCCCCCATTGGTGGAGG - Exonic
1008611656 6:53189899-53189921 TATTCCACCTACATTAGTGGTGG - Intergenic
1019870648 7:3757712-3757734 TCTTCCAACCCCATTGCTGGAGG + Intronic
1019940635 7:4286540-4286562 GTTTCCTCCCACATTGCTGGTGG - Intergenic
1021247647 7:18283372-18283394 TAATCCTCACATATTGGTGGAGG - Intronic
1022387822 7:29918031-29918053 TATTGCTCTCTTATTGGTGGAGG + Intergenic
1024655527 7:51448426-51448448 CATTCCTCACCCCTTGGTGGGGG + Intergenic
1027054124 7:75038563-75038585 CATTCCTACTCCATGGGTGGGGG + Intronic
1029175901 7:98664285-98664307 TATTCCTGCCCCATTGTTATAGG - Intergenic
1031767563 7:125801107-125801129 TATCTCTCCCCCAGTGGTAGTGG + Intergenic
1034094465 7:148394255-148394277 TGTTCCAGCCCCATTGGTTGAGG + Intronic
1037231808 8:16668183-16668205 TTTTCCTCAAGCATTGGTGGTGG - Intergenic
1041944206 8:63423653-63423675 TAGTCCTCCCTTATTTGTGGGGG + Intergenic
1044026267 8:87175935-87175957 AATACCCCCTCCATTGGTGGGGG + Intronic
1045419190 8:101997426-101997448 TTTTCTTCCCCTATTGGTGATGG - Intronic
1048379073 8:133847965-133847987 AATCCTTCCCCCATTGATGGTGG + Intergenic
1049752863 8:144293782-144293804 AATAACTCCCCCATTGGGGGAGG + Intronic
1053557662 9:39154696-39154718 CATTCCTCCCCCAGTGAAGGAGG + Intronic
1053821778 9:41974984-41975006 CATTCCTCCCCCAGTGAAGGAGG + Intronic
1054139452 9:61464255-61464277 CATTCCTCCCCCAGTGAAGGAGG - Intergenic
1054608792 9:67212424-67212446 CATTCCTCCCCCAGTGAAGGAGG - Intergenic
1055864607 9:80797848-80797870 TTTTCTTCCCCCCTTGGTGGGGG + Intergenic
1056554336 9:87676441-87676463 TATATCTCCCTCATTGGTGGAGG - Intronic
1057860824 9:98639466-98639488 TTTTCCTCTCCCAGGGGTGGTGG - Intronic
1059670932 9:116491690-116491712 TCTTCCTCACCCAGTGGAGGGGG + Intronic
1186557380 X:10574003-10574025 TACTCCTCCCTCTTTGGGGGAGG + Intronic
1186815275 X:13231023-13231045 TATTCCTCTCCCATTGAGTGTGG + Intergenic
1189132131 X:38510736-38510758 TTTTCATCCCTCATTGGAGGAGG - Intronic
1194852928 X:98891411-98891433 AATTTCTCCCACATTGGTAGAGG - Intergenic
1196755830 X:119156302-119156324 TATGCCACCCCCATTGGAGGAGG + Intergenic