ID: 1006763904

View in Genome Browser
Species Human (GRCh38)
Location 6:36487926-36487948
Sequence ATAACCCAACTGGCCTGATT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006763904_1006763910 8 Left 1006763904 6:36487926-36487948 CCAAATCAGGCCAGTTGGGTTAT 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1006763910 6:36487957-36487979 GGAATCTGGTGTGAAACCATAGG 0: 1
1: 0
2: 0
3: 14
4: 134
1006763904_1006763908 -6 Left 1006763904 6:36487926-36487948 CCAAATCAGGCCAGTTGGGTTAT 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1006763908 6:36487943-36487965 GGTTATCCTGGCTTGGAATCTGG 0: 1
1: 0
2: 0
3: 9
4: 110
1006763904_1006763911 22 Left 1006763904 6:36487926-36487948 CCAAATCAGGCCAGTTGGGTTAT 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1006763911 6:36487971-36487993 AACCATAGGTCTTAACACTCTGG 0: 1
1: 0
2: 1
3: 2
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006763904 Original CRISPR ATAACCCAACTGGCCTGATT TGG (reversed) Exonic
901570051 1:10152902-10152924 AGAACCCAGCTGCCCTGATGAGG + Intronic
902870107 1:19308763-19308785 ATAATCAAACTGTCCTCATTGGG + Intronic
907583725 1:55595503-55595525 ATATCCCAATTACCCTGATTTGG - Intergenic
912012437 1:104984320-104984342 ATATCTCAATTAGCCTGATTTGG - Intergenic
912579321 1:110705839-110705861 ATAACCCAACTGATATGGTTTGG - Intergenic
917969622 1:180198420-180198442 AAAACCCAGCAGGCCGGATTAGG - Exonic
920541056 1:206778245-206778267 AAAATCCAAATTGCCTGATTTGG - Intergenic
920583830 1:207138147-207138169 ATAACCAAACTGTCCGGATGGGG - Intronic
922339376 1:224643422-224643444 GTAACCACACTGGCCTGCTTTGG + Intronic
1063512135 10:6655879-6655901 ACATCCTAACTGGCCTCATTTGG + Intergenic
1069361529 10:67648458-67648480 ATAACCCAAATGGCCTGCCCAGG + Intronic
1071774591 10:88771208-88771230 ATATCCCAATTACCCTGATTTGG - Intronic
1072130517 10:92489545-92489567 ATAACCAACCTGCCCTGAATGGG - Intronic
1080147970 11:29011141-29011163 ATATCCCAATTGCGCTGATTTGG - Intergenic
1081913898 11:46718954-46718976 ATAGCCCCACTGGCCAGAATGGG + Intergenic
1084057703 11:66647266-66647288 ATAACCCAACTTCCCTGAAAGGG - Intronic
1086587150 11:88466521-88466543 ATATCCCAATTATCCTGATTTGG - Intergenic
1086986252 11:93252356-93252378 ATAACCCAGTTACCCTGATTTGG - Intergenic
1091165950 11:133476290-133476312 CCGACCCAAATGGCCTGATTGGG + Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1093008030 12:14072088-14072110 ATAATCCAACTGAGCTGATATGG - Intergenic
1095700230 12:45184223-45184245 ACAACCCAACTGGCCTCTCTGGG + Intergenic
1097476811 12:60067896-60067918 AGAACCCAACTTGCCTTACTTGG - Intergenic
1102877799 12:116461280-116461302 GAAAGCCAACTGGCCTGAGTTGG + Intergenic
1106307345 13:28524982-28525004 ATAACCCAACTGGCCAGTGATGG - Intergenic
1111197291 13:84891799-84891821 ATATCCCAATTATCCTGATTTGG + Intergenic
1114866342 14:26598574-26598596 ATCACCCAAGTTTCCTGATTGGG - Intergenic
1115002851 14:28442563-28442585 TGAACCCAAAAGGCCTGATTGGG + Intergenic
1115253979 14:31378908-31378930 ATAAAGCAACTGACCTGATTTGG - Intronic
1116288255 14:43000790-43000812 AAAACTCAACTGACCTGACTGGG + Intergenic
1117701555 14:58419161-58419183 AAAACCCAACTGGCCAGGTGAGG + Intronic
1122489529 14:102104553-102104575 ATATCCCAATTACCCTGATTTGG - Intronic
1127639256 15:60900109-60900131 ATAATACAACTGGCATCATTTGG + Intronic
1133296989 16:4758920-4758942 CTACCGCACCTGGCCTGATTTGG - Intronic
1139822345 16:69730451-69730473 AAAACCCAAGTGGGTTGATTGGG + Intergenic
1141208913 16:81958137-81958159 AAGACCCAACTGGCATGAGTTGG + Exonic
1144258851 17:13498121-13498143 ATAATCTAACTGGCCTGCTGGGG - Intronic
1145002292 17:19313840-19313862 ATGACACAACTGGTTTGATTTGG + Intronic
1147322847 17:39656590-39656612 ATAATCCATCTGGGCTGATGGGG - Intronic
926307715 2:11651061-11651083 TCAACCCAAATGTCCTGATTTGG - Intergenic
935185846 2:100732149-100732171 AGAGCCCAACTGGCCCCATTTGG + Intergenic
935276851 2:101482517-101482539 ATAACCCAGCTGGCAGGAGTGGG + Intergenic
937550950 2:123090645-123090667 ATAATCCAGCTGGATTGATTGGG + Intergenic
938957484 2:136312345-136312367 ATATCCCAATTACCCTGATTTGG - Intergenic
942427951 2:175879159-175879181 GTAACCTAGCTGGCCTGATGTGG - Intergenic
1172393161 20:34580340-34580362 GTGACCCATCTGGCCTGACTGGG - Intronic
1173459007 20:43227216-43227238 ATATCCCAATTATCCTGATTTGG - Intergenic
1182311308 22:29409856-29409878 ATCATCCAACTGGCCTCAGTTGG - Intronic
1183062482 22:35344678-35344700 GAAACCAAACTGGCCTGGTTGGG + Intronic
1184663996 22:45977999-45978021 AAAGCCCATCTAGCCTGATTCGG + Intergenic
950882877 3:16337290-16337312 ATCACCCAGCTGACCTGTTTGGG + Intronic
958046385 3:88289003-88289025 ATACCCCAATTACCCTGATTTGG + Intergenic
960595419 3:119403807-119403829 GGAACCCAACTGGGCTGATTCGG + Intronic
962735744 3:138323664-138323686 ATATCCCATCTGGCTTGAATGGG + Intronic
962988155 3:140554727-140554749 ATAACCCAAATGTCCATATTGGG + Intronic
963325477 3:143857651-143857673 ATTACCCTAGTGGCCTCATTTGG + Intergenic
963459572 3:145591764-145591786 ATATCCCAATTACCCTGATTTGG + Intergenic
964493312 3:157260552-157260574 ATGACATAACTGGCTTGATTTGG + Exonic
964901255 3:161661269-161661291 ATTACCCAAGTGACCTGTTTGGG - Intergenic
965447378 3:168791882-168791904 ATATCCCAATTACCCTGATTTGG + Intergenic
976080805 4:81352837-81352859 ATTACCCACGTGGGCTGATTTGG - Intergenic
977767279 4:100814161-100814183 ATTTCTGAACTGGCCTGATTTGG - Intronic
984292486 4:177813044-177813066 ATAACCCAACTGGCCCTGTATGG + Intronic
988148827 5:27348683-27348705 ATAACCCAGCTGGAGAGATTAGG + Intergenic
989219517 5:38940956-38940978 AAAATCCAGCTGGACTGATTAGG - Exonic
990079146 5:51891175-51891197 ATATCCCAATTACCCTGATTTGG + Intergenic
994692523 5:103035390-103035412 ATACACTAACTGGCCTGATTTGG + Intergenic
1006763904 6:36487926-36487948 ATAACCCAACTGGCCTGATTTGG - Exonic
1010026397 6:71222583-71222605 ATAAGACAACTGGCCTTAATTGG + Intergenic
1010050599 6:71499423-71499445 ATAAGTCATCTGGCCTTATTTGG + Intergenic
1011167121 6:84461373-84461395 ATAAGCCATCTGGCCTCTTTAGG - Intergenic
1011471431 6:87711807-87711829 AAAACCCAACTGCACTGATTGGG - Intergenic
1021586245 7:22211928-22211950 ATAACACAAGGGGCCTGATGTGG - Intronic
1023719694 7:43080055-43080077 ATATCCCAATTACCCTGATTTGG + Intergenic
1028090041 7:86688615-86688637 TTAACCAAACTGACCTAATTTGG + Intronic
1033516064 7:142107565-142107587 AAAACCCCACTGGCCTCACTAGG - Intergenic
1035234806 7:157489320-157489342 ATAGCCCGACTGGGCTGGTTTGG + Intergenic
1039308864 8:36294095-36294117 ATACCCCAATTACCCTGATTTGG - Intergenic
1044207255 8:89505092-89505114 ATAACCCAAATTTCCAGATTAGG + Intergenic
1045387343 8:101684349-101684371 TTAACCAAACTGACCTAATTTGG - Intergenic
1045606066 8:103778208-103778230 ATATCCCAACTACCTTGATTTGG - Intronic
1050910209 9:11058814-11058836 ATAATGCTGCTGGCCTGATTTGG + Intergenic
1062075543 9:134586616-134586638 ACAACCCAAATGCCCTGATGGGG - Intergenic
1186219879 X:7338796-7338818 ATATCCCAATTTCCCTGATTTGG + Intronic
1188356951 X:29203346-29203368 TTATCCCAACTGCCCTGATTTGG - Intronic
1191071127 X:56401234-56401256 ATGACCCAGCTGGGCTGAGTGGG - Intergenic
1194336861 X:92658931-92658953 ATACCCCAATTACCCTGATTTGG + Intergenic
1195414904 X:104609694-104609716 ATAACACAAATGACCTGATGGGG - Intronic
1200645295 Y:5775671-5775693 ATACCCCAATTACCCTGATTTGG + Intergenic