ID: 1006764130

View in Genome Browser
Species Human (GRCh38)
Location 6:36489908-36489930
Sequence TGTTAAGTCAGATCATTTAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006764128_1006764130 11 Left 1006764128 6:36489874-36489896 CCACTGAGGAGTTGGAGGGAGGG 0: 1
1: 1
2: 2
3: 44
4: 423
Right 1006764130 6:36489908-36489930 TGTTAAGTCAGATCATTTAATGG 0: 1
1: 0
2: 0
3: 13
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006764130 Original CRISPR TGTTAAGTCAGATCATTTAA TGG Exonic
901250608 1:7776167-7776189 TGTTAAGAGACATCATTAAATGG - Intronic
906541604 1:46591181-46591203 TGTAAAGTCAGCTCAATCAAAGG + Intronic
907938952 1:59068472-59068494 TGTTAAGTCATTTCCTTAAAAGG - Intergenic
909942576 1:81627378-81627400 TGGAAAGTCAGCTCAATTAAAGG - Intronic
910286265 1:85557728-85557750 GGTTAAGTGAGATCATTCAGGGG + Intronic
911388466 1:97207596-97207618 TGTTAAATGAGATCTTTTATAGG - Intronic
917699555 1:177566478-177566500 TGTTAGGTTAGATCCTTTCATGG - Intergenic
919225559 1:194695318-194695340 TGTTCAGTCAAATCTGTTAAGGG + Intergenic
921024659 1:211266459-211266481 TTTTAAGTAAAAACATTTAAAGG - Intronic
924350631 1:243111107-243111129 TATTAAGTCAGGTGATTGAAAGG - Intergenic
1066344919 10:34575307-34575329 TTTTAAGTCATCTTATTTAAAGG + Intronic
1067394776 10:45904890-45904912 TATTAATTCAGTTCATTCAAAGG + Intergenic
1067863099 10:49874021-49874043 TATTAATTCAGTTCATTCAAAGG + Intronic
1068227969 10:54131416-54131438 TATTAAGATAGTTCATTTAATGG - Intronic
1068329327 10:55540643-55540665 TGTTATGTAATATCAATTAAAGG + Intronic
1071076272 10:81756951-81756973 AGGTAAGTCAGATCATTTTGGGG - Intergenic
1071205860 10:83276622-83276644 TATTAAGTCAAATAATTTAAAGG - Intergenic
1072592881 10:96843566-96843588 TGTCCAGCCATATCATTTAAAGG + Intronic
1073877503 10:107942030-107942052 GGTTCAGTCAGATAATTTTAAGG - Intergenic
1074004192 10:109403184-109403206 TCTGAAGTCAAAGCATTTAAAGG + Intergenic
1075249583 10:120854051-120854073 TTTTAAGTCAGTACATTTTATGG - Intronic
1078842231 11:15089196-15089218 TGTTAAGTCCGTTCATTCTAGGG + Intergenic
1079552951 11:21723418-21723440 TGGTAAGTCACATCATTTGCTGG - Intergenic
1079818221 11:25090145-25090167 TGTTACTTCACATCATTTATTGG - Intergenic
1081763280 11:45591881-45591903 TGTAAAGTCAGGGCATTTAGTGG - Intergenic
1083072612 11:60001541-60001563 TGTTAATTCACATGATTAAAGGG - Intergenic
1083557908 11:63646882-63646904 TGGTTAGTTAGATCATATAATGG + Intronic
1087333107 11:96808521-96808543 ATTTAATTCAGAACATTTAAAGG + Intergenic
1089536587 11:119164088-119164110 TCTTAAGACAGATGCTTTAATGG - Intergenic
1093137716 12:15472131-15472153 TAATAAGTCTGATCATTTATTGG + Intronic
1097426866 12:59456682-59456704 TTTTAAGTCATATAAATTAAAGG - Intergenic
1100185860 12:92138850-92138872 TGTCAAGTCTAATCATTTTATGG + Intronic
1105320482 13:19315458-19315480 AGCTAAGTAATATCATTTAAGGG - Intergenic
1108834950 13:54532464-54532486 TGTTATGTCAGAAGATTTGAAGG + Intergenic
1109279147 13:60336136-60336158 TGTTTAATCAGATCATTCCAAGG - Intergenic
1111026534 13:82535361-82535383 TGTAAAGTCAGGTCGTTTATTGG - Intergenic
1112079491 13:95953509-95953531 TATTGAGTAAGATCATATAATGG + Intronic
1115074997 14:29378006-29378028 TGATATGTGAGAACATTTAAGGG - Intergenic
1118092084 14:62493137-62493159 TGTTAATTCATTTCTTTTAATGG + Intergenic
1118449581 14:65887968-65887990 TTTAAAGTCTGATCATTTAACGG - Intergenic
1119451608 14:74716660-74716682 AGTGAAGGAAGATCATTTAAAGG - Intronic
1120620766 14:86761511-86761533 TGTCAATTCAACTCATTTAATGG + Intergenic
1120885648 14:89449888-89449910 TCTTAGGTCAGATGACTTAAGGG + Intronic
1124781288 15:32637654-32637676 TGATTAGTCAGATCATCCAAGGG - Exonic
1126509414 15:49451590-49451612 TGTGTAGTCAGTACATTTAAAGG - Intronic
1128892427 15:71343085-71343107 AGTCAAGGCAGATCATTTAGGGG - Intronic
1131797014 15:96029462-96029484 TATAAAGTCAGATGATTTTAAGG + Intergenic
1132072521 15:98791161-98791183 TGTTAAGACATATTCTTTAAGGG + Intronic
1135192182 16:20363694-20363716 TGTTATGTCATGTCATTTATAGG + Intronic
1139134913 16:64190610-64190632 TGTTAGTTTTGATCATTTAAGGG + Intergenic
1140616107 16:76666436-76666458 TCTTTGGTCAGAGCATTTAATGG + Intergenic
1142812646 17:2402303-2402325 TGTGAAGTGAGAGGATTTAAGGG - Intergenic
1145104235 17:20101873-20101895 TGTTATGTCTGATGATTTTAGGG + Intronic
1146153389 17:30497456-30497478 TGGAAAGTCAGAGAATTTAAAGG - Intronic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1149011010 17:51856299-51856321 TGTTAATTCTGGTTATTTAAGGG + Intronic
1150893327 17:69179941-69179963 TTTTAAGTAATATGATTTAAAGG - Intronic
1150984105 17:70175871-70175893 TGTTTACTCAAATCATATAAAGG - Exonic
1153822038 18:8840311-8840333 TCTTGAGTCATTTCATTTAAGGG + Intergenic
1155278679 18:24215781-24215803 GGTTAAGGCAGACCATTAAAAGG + Intronic
1155934926 18:31744059-31744081 TTTTAAATCAGATCAATTAATGG - Intergenic
1156849442 18:41709084-41709106 TTTTAACTCAGATTATTTATTGG + Intergenic
1157645479 18:49265090-49265112 TGTTTAGTGAGATTGTTTAAAGG - Intronic
1158056193 18:53284185-53284207 TGTTATGTAAGATCACTAAAAGG + Intronic
1158926047 18:62261951-62261973 TGTTGACTCAGATCTATTAACGG - Intronic
1159078809 18:63712123-63712145 TGTGAAGTCAGTTCAGTGAAGGG + Intronic
1159081135 18:63737417-63737439 TGTTAATTCAGATATTTCAAGGG - Intergenic
1160446461 18:78931516-78931538 TGTTATGTCAGATGAGCTAAAGG - Intergenic
1161610951 19:5242327-5242349 TGTCAAATCAGATTTTTTAAAGG + Intronic
1164296987 19:23920278-23920300 CGTTAAGGAAGATCATTGAAGGG - Intronic
1165191414 19:34066892-34066914 TGTTAAGTCTCATCAGTGAACGG - Intergenic
926402030 2:12507179-12507201 CATTAACTCAGATCATTGAAAGG - Intergenic
926453089 2:13030536-13030558 AGTTAAGTCAGATAAATTACTGG + Intergenic
929625144 2:43399001-43399023 TGTAAAGGCAGGTCATCTAAAGG + Intronic
930494982 2:52129881-52129903 TGATAAGTCATATCAATTACAGG - Intergenic
930662316 2:54066579-54066601 TGATAAATCAGATGATTTTATGG - Intronic
932069785 2:68607861-68607883 TATTAAGGCAGCTTATTTAATGG - Intronic
935945375 2:108281346-108281368 TTTTAATTCATTTCATTTAAAGG - Intergenic
938881937 2:135599500-135599522 TATTAAGACAGTACATTTAATGG + Intronic
939564444 2:143770320-143770342 TGTTAGGTCAGATCCTGTGATGG - Intergenic
939743839 2:145945091-145945113 TGTAAAGTGAGATCACTTATTGG + Intergenic
939816449 2:146902838-146902860 TTTAAGGTCAGAGCATTTAAGGG - Intergenic
939924914 2:148160601-148160623 TGTTGAGTAGGATCATTTCAAGG + Intronic
940065999 2:149630148-149630170 AGTTAAGTCAATTGATTTAAGGG - Intergenic
942986900 2:182154093-182154115 AGTTTATTCAGATTATTTAAAGG - Intronic
943252977 2:185553430-185553452 TTTTGAGTGAGATGATTTAAAGG + Intergenic
943306691 2:186271414-186271436 TGTAAAGTCAGATAGTTTGAGGG + Intergenic
946610373 2:221451258-221451280 TATTAATTCAGATTATTTTAGGG - Intronic
1169360553 20:4945045-4945067 AGTTAAGTCATTTCATTCAAAGG - Intronic
1169651398 20:7871903-7871925 TGTAAAATCACAACATTTAATGG - Intergenic
1170844742 20:19952869-19952891 TATTAACTCAGATCAATTAGGGG - Intronic
1177524815 21:22277370-22277392 TTTTAAGTAAGCTCATTTAGTGG - Intergenic
1177922629 21:27171444-27171466 TGTTCCCTCAGATCATATAAAGG - Intergenic
1178085082 21:29104376-29104398 TGAGAAGTCAACTCATTTAAAGG - Intronic
1178139899 21:29670772-29670794 TGTTAATACAGTTCATTAAAGGG - Intronic
1178269962 21:31180634-31180656 TGTTAGATTAGATTATTTAAAGG - Intronic
1178960839 21:37063486-37063508 AGTTAAGTCTAATCATGTAAGGG + Exonic
951105455 3:18736846-18736868 TGTTAAGTCAGAGAATTCAGAGG + Intergenic
951864864 3:27296981-27297003 TTTTAAGTCAAATGAGTTAAAGG + Intronic
952547751 3:34439582-34439604 TGTTAATTCAGCTCATTGAAAGG + Intergenic
952582269 3:34848427-34848449 TGTTTAGGCAGATCACTAAAAGG - Intergenic
956812982 3:72882373-72882395 TGTTAACTCATATAATCTAAGGG - Intergenic
957920806 3:86746328-86746350 TGTTACGTTAGAATATTTAAAGG - Intergenic
958116053 3:89219588-89219610 TGTTAATACAGATCATTCCAGGG + Intronic
958706363 3:97661656-97661678 TCTTAAACCAGATCATTAAAAGG + Intronic
960959887 3:123062847-123062869 TCTTAAGTCTGAACATTGAAGGG - Intergenic
964251818 3:154726870-154726892 TATTGAATCAGAGCATTTAAGGG + Intergenic
964546268 3:157837523-157837545 GGTTAATTCAGACCATTTCATGG - Intergenic
965114324 3:164468529-164468551 AGTTAAGTCTGATCCTTTAAAGG - Intergenic
965779768 3:172272537-172272559 TATTAAGTAAGATCATTTCCAGG - Intronic
970786997 4:19810080-19810102 TTTTTAGTCAGATCATTGGAAGG - Intergenic
971308085 4:25501246-25501268 GTTTAAGTCAGATAATTTTAGGG + Intergenic
971604844 4:28644970-28644992 TGTTAATATAGATCCTTTAAAGG - Intergenic
972036057 4:34522855-34522877 TTTTAAATCAGATTATTTAGGGG + Intergenic
972443420 4:39118916-39118938 TCTTAAGTGAGATCACTTGATGG + Intronic
974487368 4:62523125-62523147 TGTTAACACAGATCATAAAATGG - Intergenic
976014589 4:80536307-80536329 TATTAAATCAGAGCATATAAGGG - Intronic
978073005 4:104494266-104494288 TGTAAAGTCACATTGTTTAAAGG - Intronic
979019251 4:115474863-115474885 TGTTAAGTCAGAGACTATAAAGG - Intergenic
979251304 4:118569441-118569463 TATTAAGTCAGGTGATTGAAAGG + Intergenic
979275454 4:118810230-118810252 TTCTAAGTCAGATCATGTCATGG - Intronic
981887245 4:149691039-149691061 TGTTAAGTGATATCATATTAAGG + Intergenic
983387434 4:167082933-167082955 TGTGAAGTCAGATCAGTTTCCGG - Intronic
984471560 4:180182547-180182569 TGTTAAGTCAAAATATTGAACGG - Intergenic
984921076 4:184765054-184765076 TGTTCAGTAAGTTCATTCAATGG + Intronic
985150971 4:186946671-186946693 GGCTAAGTGAGATAATTTAAAGG + Intergenic
987667826 5:20967621-20967643 TGTTAAGTCTGATTTTTTATTGG + Intergenic
987840095 5:23212302-23212324 TTTTAAGTGGGCTCATTTAAGGG + Intergenic
988824990 5:34927715-34927737 TCTAAAGTCTGGTCATTTAAAGG + Intergenic
989199823 5:38752235-38752257 TGTTCAGTCATATAATTTTATGG - Intergenic
991417357 5:66406341-66406363 TGTTAAGTGAGAAAATTCAAGGG + Intergenic
993073748 5:83200033-83200055 TGTTAGGTGAGAACATTTAGTGG - Intronic
994726078 5:103437269-103437291 TGATAAGCCACATCTTTTAAAGG - Intergenic
995574091 5:113511745-113511767 TGTTCAGCCAGGTCATTTAGGGG - Intergenic
996630724 5:125629107-125629129 AGTTAAGATAGATCATTTATGGG + Intergenic
996690237 5:126332709-126332731 TTTAAAGTCAGTTCATTTAGAGG - Intergenic
997397941 5:133579636-133579658 TGTTAAGTTGTATCATTTATTGG - Intronic
997812436 5:136984825-136984847 TTCTAAGTAAGATCATTGAATGG - Intronic
1001298999 5:170520169-170520191 AATTAAGTGAGATAATTTAAGGG - Intronic
1003856100 6:10277191-10277213 TGATAAGGCAGATTATTCAAAGG - Intergenic
1005441322 6:25872082-25872104 TCTAAATTCATATCATTTAATGG - Intronic
1006764130 6:36489908-36489930 TGTTAAGTCAGATCATTTAATGG + Exonic
1008012561 6:46483928-46483950 TGTAAATTCAGATAAATTAATGG - Intronic
1008486596 6:52042678-52042700 TGGCAAGTGAGTTCATTTAAGGG + Intronic
1010067851 6:71706944-71706966 GGTTAAGTCAAATGATTAAAGGG + Intergenic
1010337843 6:74709502-74709524 TAGAAAGTGAGATCATTTAAGGG - Intergenic
1010359575 6:74977392-74977414 TGGTAAGTCAGACCATTTAGTGG - Intergenic
1011118965 6:83928770-83928792 AGATAAGTCAGATAATTTCAGGG - Intronic
1012212509 6:96538985-96539007 TTTTAAGTCAGATGTTTTGATGG - Intronic
1012411540 6:98963991-98964013 TTTTGAGTCAGTTCTTTTAAGGG - Intergenic
1017087688 6:150729634-150729656 TTTAAAGTCAGGTCATATAATGG - Intronic
1019115345 6:169756469-169756491 TGTTCATTCAGATAATTTAATGG - Intronic
1021226570 7:18034935-18034957 TTTAAAGTCAGGTAATTTAATGG + Intergenic
1021625764 7:22591681-22591703 TGTAAAATCACATCATTGAAAGG - Intronic
1023688968 7:42766183-42766205 TGTTAAATCAGATCATATGTAGG + Intergenic
1026513244 7:71044885-71044907 TGTGAAGTCAAATCATTTACAGG + Intergenic
1031018929 7:116605631-116605653 TGTTAAGTCAAACCATTCTAAGG + Intergenic
1031638525 7:124132383-124132405 TGATAAGTCAGATCAATAATGGG - Intergenic
1031675989 7:124612743-124612765 TGTTAAGTCAGTTTATTATAGGG - Intergenic
1031878065 7:127164105-127164127 TGTGAGATCCGATCATTTAAAGG + Intronic
1032753991 7:134870885-134870907 TGTAAAATCTGATCATTTATGGG + Intronic
1034644868 7:152636474-152636496 TGTTAAGTCAAAACATGTAAGGG + Intergenic
1038387553 8:27163534-27163556 AGTTAAGTCAGATCACTTACAGG + Intergenic
1040467372 8:47707549-47707571 TGTTAAGAAAAATCATTAAAAGG - Intronic
1041370524 8:57154867-57154889 TGATAAGACATATCATTTGATGG + Intergenic
1042745973 8:72106297-72106319 TTGTAAGTCAGGTCATTTATTGG - Intronic
1043270351 8:78325431-78325453 TGTTAAGTTCCCTCATTTAAAGG - Intergenic
1043564038 8:81528003-81528025 TTTTAAGTAAGCTCATATAATGG - Intronic
1043966074 8:86477872-86477894 TTTTAAGACAGGTCATTTTAAGG - Intronic
1044079985 8:87871868-87871890 TGTAAAGTGAGATCATTTCCAGG + Exonic
1044316790 8:90758827-90758849 TGTTCTGTGTGATCATTTAAGGG + Intronic
1046725091 8:117665459-117665481 TGTGAAGTGAGTTCATTTAATGG + Intergenic
1046968838 8:120197645-120197667 TGCTGAGTAAGATCAATTAAAGG - Intronic
1048041282 8:130731075-130731097 TTTTAAGTCACAACATTTGAGGG - Intergenic
1048186501 8:132246649-132246671 CGTTATATCAGATTATTTAATGG + Intronic
1048556758 8:135485493-135485515 TGTCACATCAGATCATTTGAGGG + Intronic
1050578000 9:7018991-7019013 TGTGAATTCAGATCACTTACAGG - Intronic
1051966847 9:22838400-22838422 TCCTAAGTCAGATCAAATAAAGG + Intergenic
1056884018 9:90422269-90422291 TGTTATGTCTGATCATTTCCTGG + Intergenic
1057412729 9:94831922-94831944 TGTCCAGTCAGTTCACTTAATGG - Intronic
1057770842 9:97966618-97966640 TGTCAAGTCAGGGAATTTAAAGG - Intergenic
1058638229 9:107057468-107057490 TGTTAAGTGGGATCATATTATGG - Intergenic
1059033580 9:110728845-110728867 TATTAAGTCACAGCACTTAACGG + Intronic
1059556799 9:115289026-115289048 TTTTAAGTCACATTATTTCAAGG + Intronic
1059658485 9:116378197-116378219 TGTGAAGTCATAGAATTTAAGGG - Intronic
1060145488 9:121248941-121248963 TTTTAAGAAAGATCATTTAGAGG + Intronic
1060315901 9:122510218-122510240 GGTGAAGTCAGATCTTCTAATGG + Intergenic
1185822124 X:3215658-3215680 TGTGAAGACAGAGCCTTTAAGGG - Intergenic
1186557023 X:10570560-10570582 TGAAAAGTCAGTACATTTAATGG - Intronic
1186668710 X:11747004-11747026 TGTTAAATTAAATAATTTAAAGG - Intergenic
1187096970 X:16159205-16159227 AGTTAAGTCTGAACATTTAAAGG - Intergenic
1187771006 X:22695995-22696017 TTTAAAATCAGATTATTTAAAGG - Intergenic
1187806196 X:23123606-23123628 TGTTAAGTGGGATCCTTTAATGG - Intergenic
1188337383 X:28953787-28953809 TTTAATGCCAGATCATTTAAAGG + Intronic
1194524494 X:94961831-94961853 TGACAAGTGAGATCATTTATTGG - Intergenic
1194543007 X:95198093-95198115 TGTTAATTCATACCATTTTATGG + Intergenic
1196235577 X:113276029-113276051 TGTTAAGTCAAAAGCTTTAATGG + Intergenic
1197235338 X:124056422-124056444 TTTTAAGTTAGATCTTTAAAGGG + Intronic
1198296075 X:135288032-135288054 TGTTATCTCATATCACTTAATGG - Intronic
1200022222 X:153221737-153221759 TGTTTTTTCAGATCATTCAAAGG + Intergenic
1200465151 Y:3507557-3507579 TGAAAAATCAGATCATTTTAAGG + Intergenic
1202341070 Y:23869230-23869252 TATTAAGTCAGCTTATTTGATGG - Intergenic
1202529696 Y:25800856-25800878 TATTAAGTCAGCTTATTTGATGG + Intergenic