ID: 1006764728

View in Genome Browser
Species Human (GRCh38)
Location 6:36494842-36494864
Sequence GAACAGCACCTTAGCCAAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006764722_1006764728 15 Left 1006764722 6:36494804-36494826 CCATTTCCAAAGGGGTTCTGGAG 0: 1
1: 0
2: 1
3: 15
4: 185
Right 1006764728 6:36494842-36494864 GAACAGCACCTTAGCCAAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 167
1006764720_1006764728 21 Left 1006764720 6:36494798-36494820 CCTTCACCATTTCCAAAGGGGTT 0: 1
1: 0
2: 1
3: 12
4: 157
Right 1006764728 6:36494842-36494864 GAACAGCACCTTAGCCAAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 167
1006764723_1006764728 9 Left 1006764723 6:36494810-36494832 CCAAAGGGGTTCTGGAGACCTTG 0: 1
1: 0
2: 3
3: 9
4: 147
Right 1006764728 6:36494842-36494864 GAACAGCACCTTAGCCAAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 167
1006764726_1006764728 -9 Left 1006764726 6:36494828-36494850 CCTTGCAGGAACAGGAACAGCAC 0: 1
1: 0
2: 2
3: 26
4: 252
Right 1006764728 6:36494842-36494864 GAACAGCACCTTAGCCAAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006764728 Original CRISPR GAACAGCACCTTAGCCAAGA GGG Exonic
901574259 1:10187374-10187396 CAAGAGCAGCCTAGCCAAGATGG + Intergenic
909005998 1:70277253-70277275 CAAGATCAGCTTAGCCAAGATGG + Intronic
910851370 1:91652237-91652259 GAACAGCACCTTCTCCATGCAGG + Intergenic
914937729 1:151994617-151994639 CAACACCAGCTTAGCCAACATGG + Intergenic
918799588 1:188955209-188955231 GAACAGCACCACAACCAAGTAGG + Intergenic
920543091 1:206793962-206793984 TTACAGCACCTGAGTCAAGAGGG + Intergenic
920940133 1:210474378-210474400 GAAGACCACCTGAGCCCAGAAGG - Intronic
924911708 1:248520670-248520692 CAAGAGCACCCTAGCCAACATGG + Intergenic
1065922732 10:30407385-30407407 GAAAATCACCTGAGCCAGGAAGG + Intergenic
1066287657 10:33983835-33983857 GAACCCCACCTTAGCCAACTGGG - Intergenic
1066685609 10:37978540-37978562 CAAGACCACCTTGGCCAAGATGG - Intergenic
1076114206 10:127884200-127884222 GAAAAGCACCTTGGCAAGGACGG - Intronic
1078221188 11:9352983-9353005 CAAGACCACCCTAGCCAAGATGG + Intergenic
1080650652 11:34220281-34220303 GAACGGCATGTCAGCCAAGAAGG - Intronic
1084023237 11:66430978-66431000 GAAGATCACCTGAGCCCAGAAGG + Intergenic
1085114174 11:73915516-73915538 GAATATCACCTTAGCCTGGAAGG + Intronic
1085324057 11:75593224-75593246 GAACAGTACCTGAGCCCAGGTGG + Intronic
1085497069 11:76979449-76979471 GAACAGCAGCCTGGCCAACATGG + Intronic
1087643703 11:100783344-100783366 GAGGATCACCTTAGCCCAGAAGG + Intronic
1088275036 11:108076120-108076142 GAAGATCACCTGAGCCCAGAGGG - Intronic
1089589638 11:119532177-119532199 AAAAAGCACCTGAGCCAAGCTGG + Intergenic
1089857390 11:121558578-121558600 GAACATCACCCTAGCGAAAATGG - Exonic
1091808070 12:3370305-3370327 GGACAGCAGCTTAACCAAGCAGG - Intergenic
1093623850 12:21323473-21323495 GAAGATCACCTGAGCCCAGAAGG + Intronic
1094793821 12:33946989-33947011 GAATAGCATGTTATCCAAGAAGG - Intergenic
1097840722 12:64318886-64318908 GAAAGGCACCTTGGCCATGAAGG + Exonic
1100315972 12:93444608-93444630 GAAGACCAGCTTAGCCAACATGG - Intergenic
1102972800 12:117183745-117183767 GGAGACCACCTTAACCAAGAAGG - Intronic
1103105350 12:118219682-118219704 GAACATCACCTGAGCCCAGGAGG - Intronic
1108152662 13:47552566-47552588 GAAAAGCACATCAGCCAGGAGGG + Intergenic
1110150904 13:72251879-72251901 GAACAGCATCCGAGACAAGATGG - Intergenic
1110657575 13:78018671-78018693 CAAGAGCAGCCTAGCCAAGATGG - Intergenic
1113661093 13:112106861-112106883 GAAAAGAACCTTCGCCGAGAAGG - Intergenic
1113908047 13:113829385-113829407 GATCCACACCTGAGCCAAGAAGG + Intronic
1113908094 13:113829568-113829590 GATCCACACCTGAGCCAAGAGGG + Intronic
1113908166 13:113829844-113829866 GATCCTCACCTGAGCCAAGAGGG + Intronic
1113908178 13:113829890-113829912 GATCCACACCTGAGCCAAGAAGG + Intronic
1113908189 13:113829936-113829958 GATCCTCACCTGAGCCAAGAGGG + Intronic
1113908199 13:113829982-113830004 GATCCACACCTGAGCCAAGAGGG + Intronic
1115798292 14:36963362-36963384 GAACAGCATGTTAGCAAAGAAGG + Intronic
1115841718 14:37479173-37479195 GAACAACACTTTAGCCCAAATGG + Intronic
1117379471 14:55146201-55146223 CAACACCAGCCTAGCCAAGATGG - Intergenic
1117387344 14:55229198-55229220 GAGCAGCACCAAATCCAAGATGG + Intergenic
1118413957 14:65512706-65512728 CAACAGCAGCCTGGCCAAGATGG + Intronic
1119269910 14:73294187-73294209 GAACAGCACCTCAGACATCAGGG + Intronic
1121146358 14:91586292-91586314 GAACAGCACAATAGCACAGAGGG - Intronic
1123030074 14:105447435-105447457 GAGCAGAACCTCAGCCAAGGGGG - Intronic
1124375167 15:29125084-29125106 GCACATCAGCCTAGCCAAGAGGG + Intronic
1124552376 15:30693431-30693453 GCACAGCACCTTCCCCAGGAAGG + Intronic
1124678863 15:31712235-31712257 GCACAGCACCTTCCCCAGGAAGG - Intronic
1127994062 15:64142236-64142258 GAACATCACCTGAGCCCAGGAGG + Intronic
1129033978 15:72638874-72638896 GATCAGCACGCTGGCCAAGATGG + Intergenic
1129215904 15:74098342-74098364 GATCAGCACGCTGGCCAAGATGG - Intergenic
1129733045 15:77942674-77942696 GATCAGCACGCTGGCCAAGATGG - Intergenic
1129921708 15:79324877-79324899 GTTCAGTACCTTACCCAAGATGG - Intronic
1134415906 16:14043160-14043182 TATCAGCACCATAGTCAAGAAGG - Intergenic
1135316188 16:21446892-21446914 GAACAGCGTCTTACCCCAGAAGG - Intronic
1135369113 16:21879154-21879176 GAACAGCGTCTTACCCCAGAAGG - Intronic
1135442703 16:22491989-22492011 GAACAGCGTCTTACCCCAGAAGG + Intronic
1135576037 16:23586533-23586555 GAAGAGCAGCCTGGCCAAGATGG - Intronic
1135788280 16:25370409-25370431 GAAGAGTAGATTAGCCAAGAAGG + Intergenic
1136312865 16:29425617-29425639 GAACAGCGTCTTACCCCAGAAGG - Intergenic
1136326299 16:29527382-29527404 GAACAGCATCTTACCCCAGAAGG - Intergenic
1136440988 16:30267366-30267388 GAACAGCGTCTTACCCCAGAAGG - Intergenic
1137013447 16:35347229-35347251 GAAAGGCAGCTTCGCCAAGATGG - Intergenic
1138416108 16:56872343-56872365 GAACAGCACCTGGGCCTGGAGGG - Exonic
1139108754 16:63863265-63863287 GAAGAGCACCTGAGCCCAGAAGG - Intergenic
1139784074 16:69376768-69376790 GAAGAGCACCTGAGCCCAGGAGG + Intronic
1140171671 16:72611132-72611154 GAAAATCACCTGAGCCAGGAAGG + Intergenic
1140297890 16:73726769-73726791 GAACAGCACTCAAGCCATGAGGG + Intergenic
1141519729 16:84570668-84570690 GAACATCAGCTGAGCCAGGAGGG - Intronic
1142132584 16:88437739-88437761 CAACTACACCTTCGCCAAGAAGG + Exonic
1142742406 17:1938848-1938870 CAACACCACCCTAGCCAACATGG + Intronic
1142762960 17:2052057-2052079 GACCAGCAGCTTGGCCAAGAGGG + Intergenic
1144497252 17:15756556-15756578 GAACAGCACGTTTGCAGAGATGG + Intergenic
1144652377 17:17015070-17015092 GAACAGCACGTTTGCAGAGATGG - Intergenic
1144667365 17:17111354-17111376 GACCAGCACCCTGGCCATGAAGG + Intronic
1144737664 17:17564055-17564077 CAAAACCACCTTAGCCAAGAGGG - Intronic
1145160614 17:20571605-20571627 GAACAGCACGTTTGCAGAGATGG + Intergenic
1147042233 17:37727843-37727865 CATCAGCACCTGAGCCAGGAGGG - Intronic
1149934717 17:60793295-60793317 CAACACCAGCTTGGCCAAGATGG - Intronic
1152002765 17:77656691-77656713 CAAGACCACCTTGGCCAAGATGG - Intergenic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1154994843 18:21630557-21630579 GAAGACCAGCTTGGCCAAGAGGG + Intergenic
1157888485 18:51391865-51391887 GAACAGCAGCTGAGACAACAAGG - Intergenic
1161335748 19:3712340-3712362 TGACAGCACCTTAGCGTAGATGG + Intronic
1162040112 19:7965757-7965779 GAACTGCTCCTTAGCCTGGAAGG - Intronic
1163670718 19:18626796-18626818 CAACAGCAGCTTGGCCAACAGGG - Intergenic
1163964684 19:20734179-20734201 CAAGACCACCTTAGCCAATATGG - Intronic
1165382692 19:35492286-35492308 GAACACTCCCTTAGCCCAGATGG + Intronic
928538098 2:32259183-32259205 GAAGATCACCTGAGCCCAGAAGG - Intronic
930364995 2:50428323-50428345 GAAGATCACCTAAGCCCAGAAGG + Intronic
933960460 2:87405278-87405300 AAAGAGCACCTTGGCCAACATGG + Intergenic
934244536 2:90295980-90296002 AAAGAGCACCTTGGCCAACATGG + Intergenic
934264315 2:91501492-91501514 AAAGAGCACCTTGGCCAACATGG - Intergenic
936513045 2:113164050-113164072 CAACACCAGCTTGGCCAAGATGG - Intronic
943750228 2:191502905-191502927 TAAGAGCACCGTGGCCAAGAAGG + Intergenic
945458949 2:210082021-210082043 GAGCATCACTTGAGCCAAGAAGG - Intronic
947677370 2:231994900-231994922 GAAAATCACCTGAGCCTAGAAGG - Intronic
948550328 2:238766547-238766569 GAATAGCAAATAAGCCAAGAAGG - Intergenic
1169397918 20:5251425-5251447 GAACAACACTTTAGACCAGATGG - Intergenic
1170416681 20:16150614-16150636 GAACATCACCTGAGCCCAGAAGG - Intergenic
1170780596 20:19422232-19422254 GCACAGCACTGTGGCCAAGATGG - Intronic
1172067174 20:32229862-32229884 GACCACCACCTGAGCCCAGAAGG - Intronic
1174016274 20:47490840-47490862 GAATAGCTCCTAAGCCAAGCTGG + Intergenic
1175912892 20:62413155-62413177 GAAAAGCACCTTAGCAATTAGGG - Intronic
1180694206 22:17741676-17741698 CAAGACCACCCTAGCCAAGATGG - Intronic
1180782145 22:18526848-18526870 GAAGACCAGCTTGGCCAAGATGG + Intergenic
1181239034 22:21466186-21466208 GAAGACCAGCTTGGCCAAGATGG + Intergenic
1181256731 22:21567726-21567748 GAGCAGCACCAAATCCAAGATGG + Intronic
1182630283 22:31679813-31679835 GAAGACCAACTTAGCCAACATGG - Intronic
1184380724 22:44143519-44143541 GCCCAGCACATTAGCCAAGGAGG - Intronic
955605090 3:60693199-60693221 GATCAGCACCTTATCCAAGAAGG - Intronic
956958614 3:74371820-74371842 GAGCAGGACCTTAACCATGAAGG - Intronic
958699547 3:97570527-97570549 GAACACCAGCCTGGCCAAGATGG + Intronic
961044932 3:123701545-123701567 GAACAGGCCCTTTGCCCAGAGGG - Intronic
961320779 3:126073238-126073260 GAAGACCAGCTTAGGCAAGATGG + Intronic
963824455 3:149936966-149936988 GAACATCCCCTAACCCAAGATGG - Intronic
964099999 3:152977740-152977762 CAAGAGCACCTTAGGCAACATGG + Intergenic
965926739 3:173989820-173989842 GAACAGCACACAAACCAAGAAGG + Intronic
967683065 3:192387795-192387817 GAGCATCACCTGAGCCAAGGAGG + Intronic
967936658 3:194733655-194733677 GAACAGCACTATAGACCAGACGG + Intergenic
968636174 4:1681296-1681318 GAAGAGCAGCTTGGCCAACATGG - Intronic
970064686 4:12079360-12079382 GAACATCACCTTCTCCAAGGTGG + Intergenic
970762621 4:19509505-19509527 CAAGACCAGCTTAGCCAAGATGG - Intergenic
971816485 4:31497026-31497048 CGACAGCATCTTAGCCAACATGG + Intergenic
973537722 4:51900941-51900963 GAACAGGACGTTAGCCAGGGAGG - Intronic
974032423 4:56787791-56787813 GAACAGCAGCTTAGGGGAGAAGG + Intergenic
974142001 4:57899602-57899624 CATCAGCTCCTGAGCCAAGATGG + Intergenic
977283007 4:95066031-95066053 GAACAGCAGCTGTCCCAAGAAGG - Intronic
980135645 4:128856131-128856153 TAATAGCACCTTAGCTCAGAAGG + Intronic
981337458 4:143582968-143582990 GAAGAGCACCTGAGCCCAGGAGG - Intronic
989078276 5:37587978-37588000 GAACAGGACTTTTGCCAACATGG - Intronic
990321078 5:54630450-54630472 AAGCAGCACTTTCGCCAAGATGG - Intergenic
990752894 5:59038214-59038236 GACCAGCACCTTAGCACATATGG + Intronic
992798820 5:80277469-80277491 GAACCTCTCCTTAGGCAAGATGG - Intergenic
994409283 5:99386133-99386155 AAACAGAACATTAGCCAAGAAGG - Intergenic
994773404 5:104012502-104012524 TTTCAGCACGTTAGCCAAGATGG - Intergenic
996581383 5:125035826-125035848 GAAAAGCACCTGAGGAAAGAGGG + Intergenic
997330962 5:133061420-133061442 GAACAGCAACTTAGAAAACACGG - Intronic
999203479 5:149832658-149832680 GGACAGCACCCAAGACAAGAAGG + Exonic
999466435 5:151810476-151810498 GAACAGGACCTCAAACAAGAGGG - Exonic
1000331627 5:160210415-160210437 GAACAGCACCTCAAACATGAAGG + Intronic
1001171696 5:169425383-169425405 GAACAGAACCTTTCCCAGGAAGG - Intergenic
1002034358 5:176455357-176455379 GAGCATCACCTTAGCCTAGGAGG + Intronic
1003257980 6:4490545-4490567 AATCAGCTCCTGAGCCAAGAGGG + Intergenic
1004806325 6:19207086-19207108 GAACATCATCTGAGCCCAGAAGG + Intergenic
1006764728 6:36494842-36494864 GAACAGCACCTTAGCCAAGAGGG + Exonic
1010043596 6:71416367-71416389 AGACAGCACCTGAGCCAAGGAGG + Intergenic
1010330084 6:74613431-74613453 GAACATCACCTGAGCCCAGGAGG - Intergenic
1010430656 6:75774992-75775014 CAACACCACCCTAGCCAACATGG - Intronic
1013169798 6:107626582-107626604 GCACAGCACCTCACCCATGATGG + Intronic
1019629818 7:2042983-2043005 GAAAGTCACCTTCGCCAAGAAGG + Intronic
1019948528 7:4350081-4350103 GAAGACCAGCTTAGCCAACATGG + Intergenic
1022354757 7:29602998-29603020 AAACAACACGTTAGCCTAGAAGG - Intergenic
1024583217 7:50817803-50817825 GAACAGCACAGAGGCCAAGAGGG - Intergenic
1026661621 7:72307911-72307933 GAACACAACCTAACCCAAGAGGG + Intronic
1027922789 7:84417699-84417721 TAACATCACCTTAGACATGAAGG + Intronic
1038429095 8:27485547-27485569 GCACACCAGCTTAGCCAAGCAGG - Intergenic
1042462277 8:69083526-69083548 GACAAGCACCTTAACAAAGAAGG - Intergenic
1046268825 8:111866244-111866266 CAACACCAGCTTGGCCAAGATGG + Intergenic
1049053193 8:140215250-140215272 GCACAGCACCTTTACCTAGAAGG + Intronic
1049184282 8:141241231-141241253 GAGCAGCAGCACAGCCAAGAAGG + Intronic
1049454120 8:142678379-142678401 GAACAACAGCATACCCAAGAGGG + Intronic
1050159176 9:2699176-2699198 GAACAGAAGCTTAGCAAAGAGGG - Intergenic
1051279541 9:15427908-15427930 CAACAGCAGCTTGGCCAATATGG + Intronic
1051639574 9:19212255-19212277 GAAGACCAGCTTGGCCAAGATGG + Intergenic
1054749518 9:68890243-68890265 GAACAGTAACTTAGCCTAGACGG + Intronic
1056293526 9:85168440-85168462 GAGCAGCAAGTTAGCTAAGAAGG + Intergenic
1057256325 9:93550630-93550652 GGACAGCGCCTGAGCCAGGAAGG - Exonic
1058152048 9:101474162-101474184 GAACAGCAGCATAGCCAAAATGG - Exonic
1059140844 9:111851807-111851829 GAACAGCTCATTAGCCCAGGGGG - Intergenic
1061508891 9:131048652-131048674 TAACAGCACCTCAGGCAAGGAGG - Intronic
1062251901 9:135602275-135602297 GAACAGAACCTTAGCCTAAACGG + Intergenic
1189420679 X:40855069-40855091 TAACAGCATATTAGACAAGAAGG + Intergenic
1190839992 X:54134961-54134983 GAACAGCCCCTTTGCCAATTGGG - Exonic
1196026290 X:111044595-111044617 GGCCACCACCATAGCCAAGAAGG - Intronic
1198531706 X:137554575-137554597 GAAGATCACCTGAGCCCAGAAGG + Intergenic
1201532435 Y:15006711-15006733 CAACAGCAGCCTGGCCAAGATGG - Intergenic
1202013587 Y:20375115-20375137 GAACAGCAACTTGGCCACGGTGG + Intergenic