ID: 1006770301

View in Genome Browser
Species Human (GRCh38)
Location 6:36547422-36547444
Sequence CGTCTCCGCGGCGGGGGACC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006770301_1006770314 -2 Left 1006770301 6:36547422-36547444 CCCGGTCCCCCGCCGCGGAGACG 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1006770314 6:36547443-36547465 CGGGCTGGCGCGGCAGCCCGGGG 0: 1
1: 0
2: 2
3: 15
4: 259
1006770301_1006770318 26 Left 1006770301 6:36547422-36547444 CCCGGTCCCCCGCCGCGGAGACG 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1006770318 6:36547471-36547493 ACTACGCATGCGCGACTTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 17
1006770301_1006770313 -3 Left 1006770301 6:36547422-36547444 CCCGGTCCCCCGCCGCGGAGACG 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1006770313 6:36547442-36547464 ACGGGCTGGCGCGGCAGCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 202
1006770301_1006770312 -4 Left 1006770301 6:36547422-36547444 CCCGGTCCCCCGCCGCGGAGACG 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1006770312 6:36547441-36547463 GACGGGCTGGCGCGGCAGCCCGG 0: 1
1: 0
2: 2
3: 15
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006770301 Original CRISPR CGTCTCCGCGGCGGGGGACC GGG (reversed) Exonic
901086145 1:6613543-6613565 AGGCTCCGCGGCGGCGGCCCCGG - Intronic
902169602 1:14599162-14599184 CGCCTCGGCGGCGGGGGACTCGG + Exonic
902610805 1:17596133-17596155 AGTCTCTGGGGCGGGGGCCCTGG + Intronic
905803870 1:40862199-40862221 CTGCTCTGCGGCGGGAGACCCGG + Exonic
911188451 1:94926438-94926460 CGTCTGCGCGGCCAGGGACCCGG - Intronic
911601193 1:99849998-99850020 CGGCTCCGGGCCGGGGGACCTGG - Intergenic
915255747 1:154627469-154627491 ACTCTCCGAGGCGGGGGAGCCGG + Intronic
916414036 1:164576388-164576410 CGGCGCCGCGCCGGCGGACCGGG - Intronic
1063112231 10:3047077-3047099 TGTCTCCGGGGCTGGGAACCTGG + Intergenic
1064764762 10:18659564-18659586 CCGCGCCGCGGTGGGGGACCCGG + Exonic
1070147556 10:73785836-73785858 CGGATCCGCGGGGGGGGACCCGG + Exonic
1073325842 10:102643724-102643746 TCTCTCCGCGGCGGGGGCGCCGG + Intergenic
1074866596 10:117547534-117547556 CCTCTTCGTGGCGGGGGCCCTGG - Intronic
1076605006 10:131683639-131683661 CATCTCCGTGGAAGGGGACCTGG - Intergenic
1076802099 10:132835578-132835600 CGTCTCCACAGCATGGGACCAGG - Intronic
1077635829 11:3840901-3840923 CCTCCCCGAGGCGGGGGAGCTGG + Exonic
1078180273 11:9004665-9004687 CGTTTCCGAGCCGGGGGAGCAGG + Intergenic
1079126165 11:17719974-17719996 CTTCCCCGCGGCGGTGCACCCGG + Exonic
1079603786 11:22341856-22341878 CCTCTCAGTGGCGGGGGAACGGG - Intronic
1082003657 11:47408427-47408449 CCTCGCGGCGGTGGGGGACCCGG - Intronic
1095271461 12:40224618-40224640 CGCCTCCGCTGCGGGGCTCCGGG + Intronic
1096079351 12:48823388-48823410 CGTCTCCCTGGAGGAGGACCGGG + Exonic
1096250067 12:50025299-50025321 CGTGGCCGCCGCGGGGGTCCGGG - Intronic
1096533969 12:52258908-52258930 GGTGCCCGCTGCGGGGGACCGGG - Intronic
1102962040 12:117099283-117099305 GGTGCCCGCGGCGGGGGCCCCGG + Exonic
1103942037 12:124506429-124506451 CTTCGCCGTGGCGGGGGAGCAGG - Intronic
1114269196 14:21090944-21090966 CGTCTCCGCAGCCTGCGACCTGG - Exonic
1116186798 14:41608299-41608321 CGGCTCCGCGCCCGGGGAGCGGG - Exonic
1117251850 14:53946837-53946859 CGTCCTCCCTGCGGGGGACCAGG - Intergenic
1118729543 14:68656710-68656732 CCTCTCAGGGGTGGGGGACCTGG - Intronic
1122973930 14:105163426-105163448 CGTCTTCACGGTGGGGGACCTGG - Intronic
1123964047 15:25438370-25438392 CGCCTCGGCGGCGGGGGGCGGGG + Intronic
1125973083 15:43928157-43928179 TGTCTTCACGGCGGGGGAGCAGG - Intronic
1127342909 15:58065901-58065923 GGTCTCCGCGGCCGGGGGGCGGG - Exonic
1128454185 15:67823445-67823467 CATCTCCGCGCCCGGGGTCCCGG + Intronic
1129104432 15:73296351-73296373 CATCCCCACGGCGGGGGAGCTGG - Intronic
1131032253 15:89196056-89196078 CCTCTCCGAGGGGAGGGACCTGG - Exonic
1134121239 16:11586547-11586569 CCTCTCCGGGGAGGGGGACGCGG + Intronic
1134150027 16:11797863-11797885 CGTGCCCGCAGCGGGGCACCTGG - Intergenic
1136399795 16:30011068-30011090 CGGCGCGGCGGCGGGGGACGGGG + Exonic
1138619104 16:58197781-58197803 CGGCGGCGCGGCGGGGGACGCGG + Exonic
1142424084 16:89991602-89991624 CTTCTCTGGGGAGGGGGACCAGG + Intergenic
1143548518 17:7614609-7614631 CGTCTCCCCGGAGGAGGAGCCGG + Exonic
1145094075 17:20009569-20009591 CGTCTTCGCCGCGGGGGCCCCGG + Intronic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1148714817 17:49708323-49708345 CTTTTCCGCGGCGGGCGGCCAGG + Intronic
1152352263 17:79790535-79790557 GGCCACCGCGGCGGGGAACCTGG - Intergenic
1152467890 17:80476060-80476082 CGTCTCGGCGGCCGGTGTCCGGG + Exonic
1155199349 18:23503587-23503609 CGCGCCCGCGGCGGGGGCCCCGG - Exonic
1160719589 19:591312-591334 CGTGACCGCGGCGGGGTTCCCGG + Intronic
1160897059 19:1407945-1407967 CGGCTTCGCGCCGGGGGCCCTGG + Intronic
1161029525 19:2051217-2051239 CCTCTCAGCGGCGGTGGCCCAGG - Exonic
1167463853 19:49640040-49640062 CGGCCCCGGGGCGGGGGACCTGG - Exonic
1168694376 19:58396437-58396459 GGAGTCCGCGGCGGGGGGCCAGG - Exonic
927938127 2:27086679-27086701 CGCCTCCGCCGCGGAGGAGCAGG - Intergenic
927982143 2:27380775-27380797 CGTCTCTGCGGCGGCGGAAGCGG - Intronic
929857544 2:45650031-45650053 CGGCTCCGCTGCCGGGGAGCTGG - Intergenic
930011417 2:46941029-46941051 CGACTCCGCGGCGGGGGCGGCGG + Intronic
934566971 2:95346583-95346605 CGGCGCGGCGGCGGGGGTCCCGG - Intronic
937301049 2:120842174-120842196 CGTCTCCAGGGAGGGGAACCAGG - Intronic
938104540 2:128520990-128521012 CGTCTCCAGGCCTGGGGACCTGG + Intergenic
1169231137 20:3889529-3889551 CGTCTCGTCGGCTGGGGAGCAGG + Exonic
1171866338 20:30489259-30489281 AGTCTCCGCGGTGGGGACCCAGG - Intergenic
1172702687 20:36862891-36862913 CGAGTCCGCGGCCGGGGGCCCGG - Exonic
1176121665 20:63456869-63456891 CCTCCCCGGGGCTGGGGACCTGG + Intronic
1176185169 20:63774488-63774510 CACCTCCGCGGCTGGGGTCCAGG - Intronic
1176549472 21:8214934-8214956 CGTCTCCTCGTGGGGGGGCCGGG + Intergenic
1176549491 21:8214997-8215019 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176557367 21:8259163-8259185 CGTCTCCTCGTGGGGGGGCCGGG + Intergenic
1176557386 21:8259226-8259248 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176568399 21:8397968-8397990 CGTCTCCTTGTGGGGGGACCGGG + Intergenic
1176568416 21:8398031-8398053 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176576309 21:8442198-8442220 CGTCTCCTCGTGGGGGGGCCGGG + Intergenic
1176576328 21:8442261-8442283 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1181026741 22:20131522-20131544 CGGCTCCGCGGCCCGGGACCAGG + Intronic
1182393656 22:30019996-30020018 CCTCTCCCCTGGGGGGGACCTGG - Exonic
1185398444 22:50604198-50604220 CGGCTCCGAGGCGGGCGACGAGG - Exonic
1203254359 22_KI270733v1_random:131256-131278 CGTCTCCTCGTGGGGGGGCCGGG + Intergenic
1203254378 22_KI270733v1_random:131319-131341 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1203262415 22_KI270733v1_random:176335-176357 CGTCTCCTCGTGGGGGGGCCGGG + Intergenic
1203262434 22_KI270733v1_random:176398-176420 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
952167229 3:30763496-30763518 CGTCTCGGCGGCGGGGGGTGGGG + Intronic
967858335 3:194134524-194134546 CGTGACCGCGGCGGGCGCCCAGG + Intergenic
970333319 4:15004756-15004778 CCTCCCCGCGTCGGGGGTCCGGG - Intronic
973907517 4:55546522-55546544 AGTCACCGCAGCGGGAGACCTGG - Intronic
985537578 5:473599-473621 CGTCCCCCCGCCGGGGGTCCCGG + Intronic
1003084961 6:3053693-3053715 CGGCTCCGCCCTGGGGGACCAGG + Intergenic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1008673375 6:53795212-53795234 GGTCTCCGCCGCTCGGGACCCGG + Exonic
1016590162 6:145735348-145735370 CGGCACCGCGGCGGGCGACGGGG - Exonic
1018774398 6:166999600-166999622 CGCCTCCCTGGCGAGGGACCGGG + Intronic
1019111832 6:169723733-169723755 CGTCTCGGGGGCGTGGGCCCAGG - Intronic
1019553945 7:1619471-1619493 CGTCTGAGCGGCGGGGGAGCCGG + Intergenic
1024578420 7:50782771-50782793 CGGCTCCGCGGAGGGGCCCCCGG - Intronic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1033477213 7:141702262-141702284 CGCCTCCGCGGCGGGGCCCCGGG - Intergenic
1034434760 7:151058146-151058168 CGGCGCCGCGGCGGGGCGCCCGG - Exonic
1034578841 7:152025612-152025634 CGTCACCGCGGCGCGGGGGCGGG + Intergenic
1035464180 7:159064249-159064271 TGGCTCCGGGGCAGGGGACCGGG - Intronic
1049973620 9:842006-842028 CGGCTCCGGGGCGTCGGACCTGG + Exonic
1049998359 9:1051631-1051653 TGGCTCCGCGGCCGGGGACTGGG + Exonic
1053550918 9:39078714-39078736 CGGCTCCCCGGCGCGGGAACTGG - Exonic
1053738082 9:41114245-41114267 CCTCTCCCCGGCGGGATACCAGG + Intergenic
1053815027 9:41898793-41898815 CGGCTCCCCGGCGCGGGAACTGG - Exonic
1054615569 9:67288648-67288670 CGGCTCCCCGGCGCGGGAACTGG + Intergenic
1054690267 9:68317073-68317095 CCTCTCCCCGGCGGGATACCAGG - Intergenic
1060106802 9:120877491-120877513 CCGCTCCTCGGCGGGGGGCCCGG - Intronic
1061961783 9:133992398-133992420 CGGCGGCGCAGCGGGGGACCTGG - Intronic
1062718581 9:138023320-138023342 GACCCCCGCGGCGGGGGACCAGG + Exonic
1203470760 Un_GL000220v1:114400-114422 CGTCTCCTCGTGGGGGGGCCGGG + Intergenic
1203470779 Un_GL000220v1:114463-114485 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1203478581 Un_GL000220v1:158372-158394 CGTCTCCTCGTGGGGGGGCCGGG + Intergenic
1203478600 Un_GL000220v1:158435-158457 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1189323186 X:40098188-40098210 CGCCTCCGCGGCGGGGTTTCGGG + Intronic
1190573018 X:51803557-51803579 GGTCTCCGCGGGAGGGGAACAGG - Intronic
1196791529 X:119468866-119468888 CATCTCCGAGGCGGCGGACTCGG + Intronic
1200051357 X:153433492-153433514 CCTCTCCGCCCCAGGGGACCTGG + Intergenic
1200057721 X:153470408-153470430 CCACTCCAGGGCGGGGGACCGGG - Intronic
1200247782 X:154535074-154535096 CGTGTCCGGGGCCGGGGATCTGG - Intronic