ID: 1006772029

View in Genome Browser
Species Human (GRCh38)
Location 6:36561661-36561683
Sequence GTACAGCTGGAGCAAGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006772029_1006772037 30 Left 1006772029 6:36561661-36561683 CCCACAACTTGCTCCAGCTGTAC No data
Right 1006772037 6:36561714-36561736 GTATTTCAATGGACTCTTCTTGG No data
1006772029_1006772034 19 Left 1006772029 6:36561661-36561683 CCCACAACTTGCTCCAGCTGTAC No data
Right 1006772034 6:36561703-36561725 TGTCCTCCATGGTATTTCAATGG No data
1006772029_1006772032 8 Left 1006772029 6:36561661-36561683 CCCACAACTTGCTCCAGCTGTAC No data
Right 1006772032 6:36561692-36561714 GTCAGCACCAATGTCCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006772029 Original CRISPR GTACAGCTGGAGCAAGTTGT GGG (reversed) Intergenic
No off target data available for this crispr