ID: 1006778932

View in Genome Browser
Species Human (GRCh38)
Location 6:36618683-36618705
Sequence CAGTCTCCCCAGCTGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006778923_1006778932 28 Left 1006778923 6:36618632-36618654 CCATCACCACAGGCTCTCATGAT No data
Right 1006778932 6:36618683-36618705 CAGTCTCCCCAGCTGGAAGTAGG No data
1006778924_1006778932 22 Left 1006778924 6:36618638-36618660 CCACAGGCTCTCATGATAGTGAG No data
Right 1006778932 6:36618683-36618705 CAGTCTCCCCAGCTGGAAGTAGG No data
1006778929_1006778932 -10 Left 1006778929 6:36618670-36618692 CCTTCGGGAACCTCAGTCTCCCC No data
Right 1006778932 6:36618683-36618705 CAGTCTCCCCAGCTGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006778932 Original CRISPR CAGTCTCCCCAGCTGGAAGT AGG Intergenic
No off target data available for this crispr