ID: 1006779651

View in Genome Browser
Species Human (GRCh38)
Location 6:36623648-36623670
Sequence TTCCAGGCCTTGGACCTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006779645_1006779651 19 Left 1006779645 6:36623606-36623628 CCGTCACAAGGGGGCAGGATGGG No data
Right 1006779651 6:36623648-36623670 TTCCAGGCCTTGGACCTGTCAGG No data
1006779643_1006779651 20 Left 1006779643 6:36623605-36623627 CCCGTCACAAGGGGGCAGGATGG No data
Right 1006779651 6:36623648-36623670 TTCCAGGCCTTGGACCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006779651 Original CRISPR TTCCAGGCCTTGGACCTGTC AGG Intergenic
No off target data available for this crispr