ID: 1006779922 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:36625512-36625534 |
| Sequence | CTAGGGTGGTCCACTTCTTA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1006779914_1006779922 | 25 | Left | 1006779914 | 6:36625464-36625486 | CCCTTTCTGAATGTCAAAGCCAT | No data | ||
| Right | 1006779922 | 6:36625512-36625534 | CTAGGGTGGTCCACTTCTTAGGG | No data | ||||
| 1006779917_1006779922 | 6 | Left | 1006779917 | 6:36625483-36625505 | CCATGAGATAAAGGACATATATA | No data | ||
| Right | 1006779922 | 6:36625512-36625534 | CTAGGGTGGTCCACTTCTTAGGG | No data | ||||
| 1006779915_1006779922 | 24 | Left | 1006779915 | 6:36625465-36625487 | CCTTTCTGAATGTCAAAGCCATG | No data | ||
| Right | 1006779922 | 6:36625512-36625534 | CTAGGGTGGTCCACTTCTTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1006779922 | Original CRISPR | CTAGGGTGGTCCACTTCTTA GGG | Intergenic | ||