ID: 1006779922

View in Genome Browser
Species Human (GRCh38)
Location 6:36625512-36625534
Sequence CTAGGGTGGTCCACTTCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006779914_1006779922 25 Left 1006779914 6:36625464-36625486 CCCTTTCTGAATGTCAAAGCCAT No data
Right 1006779922 6:36625512-36625534 CTAGGGTGGTCCACTTCTTAGGG No data
1006779917_1006779922 6 Left 1006779917 6:36625483-36625505 CCATGAGATAAAGGACATATATA No data
Right 1006779922 6:36625512-36625534 CTAGGGTGGTCCACTTCTTAGGG No data
1006779915_1006779922 24 Left 1006779915 6:36625465-36625487 CCTTTCTGAATGTCAAAGCCATG No data
Right 1006779922 6:36625512-36625534 CTAGGGTGGTCCACTTCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006779922 Original CRISPR CTAGGGTGGTCCACTTCTTA GGG Intergenic