ID: 1006781034

View in Genome Browser
Species Human (GRCh38)
Location 6:36632444-36632466
Sequence GATGTGATTATTAGTAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006781034_1006781040 17 Left 1006781034 6:36632444-36632466 CCTCTCCTACTAATAATCACATC No data
Right 1006781040 6:36632484-36632506 CCTGAACGTGATTACACGCTGGG No data
1006781034_1006781041 29 Left 1006781034 6:36632444-36632466 CCTCTCCTACTAATAATCACATC No data
Right 1006781041 6:36632496-36632518 TACACGCTGGGCACCGTATGAGG No data
1006781034_1006781038 16 Left 1006781034 6:36632444-36632466 CCTCTCCTACTAATAATCACATC No data
Right 1006781038 6:36632483-36632505 CCCTGAACGTGATTACACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006781034 Original CRISPR GATGTGATTATTAGTAGGAG AGG (reversed) Intergenic
No off target data available for this crispr