ID: 1006781036

View in Genome Browser
Species Human (GRCh38)
Location 6:36632449-36632471
Sequence ACCATGATGTGATTATTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006781036_1006781041 24 Left 1006781036 6:36632449-36632471 CCTACTAATAATCACATCATGGT No data
Right 1006781041 6:36632496-36632518 TACACGCTGGGCACCGTATGAGG No data
1006781036_1006781038 11 Left 1006781036 6:36632449-36632471 CCTACTAATAATCACATCATGGT No data
Right 1006781038 6:36632483-36632505 CCCTGAACGTGATTACACGCTGG No data
1006781036_1006781040 12 Left 1006781036 6:36632449-36632471 CCTACTAATAATCACATCATGGT No data
Right 1006781040 6:36632484-36632506 CCTGAACGTGATTACACGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006781036 Original CRISPR ACCATGATGTGATTATTAGT AGG (reversed) Intergenic
No off target data available for this crispr