ID: 1006781041

View in Genome Browser
Species Human (GRCh38)
Location 6:36632496-36632518
Sequence TACACGCTGGGCACCGTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006781037_1006781041 -10 Left 1006781037 6:36632483-36632505 CCCTGAACGTGATTACACGCTGG No data
Right 1006781041 6:36632496-36632518 TACACGCTGGGCACCGTATGAGG No data
1006781036_1006781041 24 Left 1006781036 6:36632449-36632471 CCTACTAATAATCACATCATGGT No data
Right 1006781041 6:36632496-36632518 TACACGCTGGGCACCGTATGAGG No data
1006781034_1006781041 29 Left 1006781034 6:36632444-36632466 CCTCTCCTACTAATAATCACATC No data
Right 1006781041 6:36632496-36632518 TACACGCTGGGCACCGTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006781041 Original CRISPR TACACGCTGGGCACCGTATG AGG Intergenic
No off target data available for this crispr