ID: 1006781990

View in Genome Browser
Species Human (GRCh38)
Location 6:36638151-36638173
Sequence CAGTGATGGTAGGAGATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006781990_1006781996 27 Left 1006781990 6:36638151-36638173 CCTCCAATCTCCTACCATCACTG No data
Right 1006781996 6:36638201-36638223 CTGTATATCTGCTTAAGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006781990 Original CRISPR CAGTGATGGTAGGAGATTGG AGG (reversed) Intergenic
No off target data available for this crispr