ID: 1006786494

View in Genome Browser
Species Human (GRCh38)
Location 6:36671098-36671120
Sequence CCTATCCCATAGAAGTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006786489_1006786494 28 Left 1006786489 6:36671047-36671069 CCTCTACATTTCAGTGACTTCAC No data
Right 1006786494 6:36671098-36671120 CCTATCCCATAGAAGTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006786494 Original CRISPR CCTATCCCATAGAAGTTGGT GGG Intergenic
No off target data available for this crispr