ID: 1006787036

View in Genome Browser
Species Human (GRCh38)
Location 6:36675219-36675241
Sequence GAACTCTATGAGAGTCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 1, 2: 1, 3: 4, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006787036 Original CRISPR GAACTCTATGAGAGTCCTTG TGG (reversed) Intergenic
901680759 1:10911458-10911480 GGACCCTATGAGAGTGCATGTGG - Intergenic
903104094 1:21059923-21059945 GGACCCTATGTGAATCCTTGAGG + Intronic
903828142 1:26159667-26159689 GGAGTCTGTGAGAGGCCTTGGGG - Intronic
905146936 1:35894128-35894150 GAACGCGCTGAGAGTCCGTGAGG - Exonic
907095356 1:51774169-51774191 GAACTGAATCAGAGTTCTTGGGG + Intronic
907461698 1:54609157-54609179 GCACTGTATGTGAGTCCTTGGGG - Intronic
907890127 1:58629137-58629159 GAAGTGGATGAGATTCCTTGAGG + Intergenic
909972981 1:82012937-82012959 CAACTCTAAAGGAGTCCTTGAGG - Intergenic
911562229 1:99419858-99419880 TAAGTTTATGTGAGTCCTTGTGG - Intergenic
912419370 1:109532740-109532762 GAACTCTGGGGGACTCCTTGGGG - Intergenic
1070970733 10:80565199-80565221 GTTCTCTATTTGAGTCCTTGTGG - Intronic
1088727024 11:112648216-112648238 GAACACTCAGAGAGGCCTTGGGG + Intergenic
1097601502 12:61698627-61698649 GTCCTATATGAGATTCCTTGTGG + Intergenic
1099003450 12:77208688-77208710 CATCTCTATCAGAGCCCTTGGGG + Intergenic
1102428921 12:112866521-112866543 GAATTCTTTAAGAGTCCCTGTGG - Intronic
1105779983 13:23697027-23697049 CAACTGTATGAGCGTCCGTGGGG + Intergenic
1108972422 13:56393610-56393632 GTCCTCTAGGAAAGTCCTTGTGG + Intergenic
1110334928 13:74316658-74316680 GAACTCTCTGAATGTACTTGCGG - Intergenic
1111111159 13:83711526-83711548 AAACTCTATGAAATTACTTGTGG + Intergenic
1111673294 13:91356128-91356150 GCACTATATTAGAGTCTTTGGGG + Intergenic
1114997231 14:28369955-28369977 GAGCCCTATGAGATTCATTGTGG - Intergenic
1117971370 14:61254070-61254092 AAACTCTATGCGAGACATTGAGG + Intronic
1120104214 14:80475978-80476000 GGACTATAATAGAGTCCTTGTGG + Intergenic
1125246910 15:37650879-37650901 GAACTCTATTAGTTTCCTTTGGG - Intergenic
1125411233 15:39408509-39408531 GAACTGTTTGAGAGTTTTTGAGG + Intergenic
1127629677 15:60815283-60815305 GAACTGTATTAGAGGCCTTCTGG + Intronic
1133469011 16:6056024-6056046 GCACTCAATGAGGGTTCTTGGGG + Intronic
1137225686 16:46505696-46505718 GAAGTCAATGAGAGACCGTGAGG + Intergenic
1141141158 16:81497674-81497696 GCACTCTATGCGAGTCCTGTGGG - Intronic
1146150146 17:30460981-30461003 AAACTCTATGAGAGCCCTTGAGG - Intronic
1154477347 18:14775645-14775667 GAACTCTTTGAGTTTCTTTGTGG + Intronic
1158086820 18:53661351-53661373 GAACTATTTGAGTGACCTTGTGG + Intergenic
1162337369 19:10070311-10070333 GACCTCCATGATAGTCATTGTGG - Intergenic
925065068 2:923086-923108 GCCCTCCTTGAGAGTCCTTGGGG - Intergenic
926704734 2:15829009-15829031 GAAGTCTAGGAGAAACCTTGAGG - Intergenic
928774032 2:34737178-34737200 AAACTTTAAGATAGTCCTTGGGG - Intergenic
930388971 2:50736338-50736360 GAGCTCTATGAGACTCCCTTAGG - Intronic
933230262 2:79798899-79798921 GAACACTGTGAGATTCATTGAGG - Intronic
933423779 2:82085240-82085262 GAACTGCATGAGAATCCATGAGG + Intergenic
933449101 2:82423480-82423502 GAATTGGATTAGAGTCCTTGGGG - Intergenic
933854253 2:86397996-86398018 GGACAGTATGAGAGTCCTGGCGG - Intergenic
934123752 2:88866306-88866328 GAACTCTAAGACAGAGCTTGAGG - Intergenic
937903253 2:127038721-127038743 GAATTTTATGAGAGACCATGAGG - Intergenic
940603523 2:155890814-155890836 GAACTCTATGATAGTTTTTTGGG + Intergenic
942589285 2:177523891-177523913 GAATAATATGAGAGTACTTGAGG + Intronic
946550949 2:220801466-220801488 GAACTCCTAGAGAATCCTTGAGG - Intergenic
947848283 2:233263268-233263290 GCCCTCTATGAGAGTCCTGTGGG + Intronic
948925599 2:241094919-241094941 GAGCTCTAAGAGGGTCCTGGAGG - Exonic
950944261 3:16928411-16928433 GGACTGTATGAGAGTCCTCCAGG + Intronic
962188056 3:133280924-133280946 GAAATATATGAGACTTCTTGAGG + Intronic
962778524 3:138688127-138688149 GAAGCCTATGAGAGTTCTTCTGG + Intronic
966569100 3:181420840-181420862 GAACCCCATGAGAGACCATGTGG - Intergenic
968261463 3:197328289-197328311 GAACTCTATTAGATACCATGTGG - Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
970596774 4:17607537-17607559 GAACTCAATGAGAGTCCTTGTGG - Exonic
970923944 4:21428349-21428371 GAACTCTATCAGTGTCCTGGTGG - Intronic
971226117 4:24752859-24752881 GAAGTCTATGAGAGGACATGAGG + Intergenic
972232890 4:37096080-37096102 GAACTCTCTGAGGCTGCTTGAGG - Intergenic
972243566 4:37220665-37220687 GAGGTCTCTGAGAGTCCTTCTGG + Intergenic
972356865 4:38287529-38287551 GAACTCAATGACAGTTCTCGAGG + Intergenic
972504651 4:39709130-39709152 GAAGATTAGGAGAGTCCTTGCGG + Intronic
973605424 4:52582529-52582551 GAGCTTTCTGAGAGTCCTTTTGG - Intergenic
975069973 4:70122181-70122203 GCAGTCTATGAGTGTCCTTATGG - Intergenic
976796674 4:88941618-88941640 GATGTCTCTGAGACTCCTTGAGG + Intronic
977803722 4:101271070-101271092 GAACTCTCTGAAAGACCTTGAGG - Intronic
982503450 4:156188829-156188851 TAACTATATCAGAGACCTTGTGG + Intergenic
982826872 4:160013306-160013328 GGACTTTATGAGAGTCATTATGG - Intergenic
983670009 4:170226104-170226126 TAACTTAATGAGAGTCCTGGAGG + Intergenic
983954273 4:173678412-173678434 GAAGTCCATGAGAGTTCTTTCGG + Intergenic
987493125 5:18606770-18606792 GAACTCTATGATAGTACCTTAGG + Intergenic
990419605 5:55618374-55618396 GAAATTTATGACACTCCTTGAGG - Intergenic
996842472 5:127862392-127862414 AAAAGCTGTGAGAGTCCTTGTGG - Intergenic
999719122 5:154385623-154385645 GAGGTCAATGAGAGTCCTTCAGG - Intronic
1001208453 5:169787328-169787350 GTACTCTAGCAGAGTCTTTGAGG + Intronic
1003428257 6:6013028-6013050 GAAAACTATGAGAATCCTTGAGG - Intergenic
1003729418 6:8804410-8804432 GATCTCTATGATAGTCTTTTAGG + Intergenic
1004829943 6:19465797-19465819 AAGCTCTGTAAGAGTCCTTGTGG - Intergenic
1006787036 6:36675219-36675241 GAACTCTATGAGAGTCCTTGTGG - Intergenic
1008168190 6:48166931-48166953 TAACTCTCAGAGAGTCCTTCAGG + Intergenic
1008982180 6:57497254-57497276 GAACAGTTTGAGAGGCCTTGAGG + Intronic
1009170244 6:60390090-60390112 GAACAGTTTGAGAGGCCTTGAGG + Intergenic
1009823217 6:68831567-68831589 GAACTCTGAGAGAGAGCTTGTGG + Intronic
1021711464 7:23420189-23420211 GAACTATAGGACAGGCCTTGTGG + Intronic
1021813067 7:24422710-24422732 GAAATGAATGAAAGTCCTTGGGG - Intergenic
1023137468 7:37066539-37066561 GAACTCTTTGAGGCTCTTTGAGG - Intronic
1026111341 7:67461045-67461067 GAACATTATAAGATTCCTTGAGG + Intergenic
1029028677 7:97445772-97445794 GATCTCTTGGAGAGTCTTTGAGG - Intergenic
1029504742 7:100956182-100956204 GGACTCTGTGACAGTGCTTGTGG - Exonic
1032379345 7:131460150-131460172 AAACCCTATGAGTATCCTTGAGG - Intronic
1032392501 7:131565057-131565079 GGACTATATTTGAGTCCTTGTGG - Intergenic
1034211214 7:149364830-149364852 AAACTTTATGGGAGTTCTTGGGG + Intergenic
1036208133 8:6820088-6820110 GAACTGTATGAGAGTCACCGGGG - Intronic
1036420124 8:8587850-8587872 AAAATCTATGAGATTCCTGGGGG - Intergenic
1039024654 8:33244580-33244602 GCATTTTATGAGAGTTCTTGGGG + Intergenic
1043354292 8:79394515-79394537 GAATTGAATGAGAGTCCCTGGGG - Intergenic
1044266597 8:90189144-90189166 GAACCATATGATAGTACTTGTGG - Intergenic
1053728402 9:41027296-41027318 GATCTCTCTGTGAGTCCTGGTGG + Intergenic
1054700103 9:68404784-68404806 GATCTCTCTGTGAGTCCTGGTGG - Intronic
1057101666 9:92366828-92366850 TAACTCCATGAGAGCTCTTGGGG - Intronic
1057631901 9:96725958-96725980 GACCTCTCTGACAGTCCGTGTGG + Intergenic
1062402061 9:136377084-136377106 CACCTCTCTGAGTGTCCTTGGGG - Intronic
1187297676 X:18017841-18017863 GAACTTAATGAGAGACCCTGTGG + Intergenic
1188834359 X:34938331-34938353 AAACTCTTTGAAAGTCTTTGGGG + Intergenic
1189006794 X:37004215-37004237 AAACTCTTTGAAAGTCTTTGCGG + Intergenic
1189632567 X:42970481-42970503 GTCCTGTCTGAGAGTCCTTGTGG - Intergenic
1194628456 X:96253766-96253788 GAAATCTTTGACAGTTCTTGTGG + Intergenic
1194638140 X:96370631-96370653 TATCTCTATGAGTGTCTTTGGGG - Intergenic