ID: 1006787234

View in Genome Browser
Species Human (GRCh38)
Location 6:36676621-36676643
Sequence CAGATCCCAGCCCTGTCGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006787234_1006787235 8 Left 1006787234 6:36676621-36676643 CCTTGCGACAGGGCTGGGATCTG 0: 1
1: 0
2: 1
3: 16
4: 223
Right 1006787235 6:36676652-36676674 GTGCTTGTGTGAGTGTGTGCTGG No data
1006787234_1006787236 9 Left 1006787234 6:36676621-36676643 CCTTGCGACAGGGCTGGGATCTG 0: 1
1: 0
2: 1
3: 16
4: 223
Right 1006787236 6:36676653-36676675 TGCTTGTGTGAGTGTGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006787234 Original CRISPR CAGATCCCAGCCCTGTCGCA AGG (reversed) Intronic
900584657 1:3426835-3426857 CAGACCACAGCCCTGTCCCCAGG - Intronic
901456586 1:9366515-9366537 CAGATCCCAGCCCTGAACCTTGG + Intronic
902414782 1:16232228-16232250 CAGCTCCCAGGCCTGCCGGAAGG + Exonic
902942205 1:19808562-19808584 CATATCTCAGCCCTGTCCCTCGG + Intergenic
904991110 1:34593393-34593415 CAGCTCCCAGCCCTGTCCCTTGG - Intergenic
905016473 1:34781847-34781869 CAAGCCCCAGCCCTGCCGCAGGG - Intronic
905308958 1:37036576-37036598 CAGATCCAAGGCCTGTGGAAGGG + Intergenic
907909743 1:58815487-58815509 CACGCCCCAGCCCTCTCGCAGGG + Intergenic
909085833 1:71169309-71169331 CAGATCCCTCCCCTGACACATGG + Intergenic
912523840 1:110266218-110266240 CAGATCCCAACACTGTTGCATGG + Intronic
915762745 1:158331324-158331346 CAGCTCCCAGCACTGGTGCAGGG - Intronic
916305279 1:163323422-163323444 AAGATCCCAGCTCTGTGGCCTGG + Intronic
919235566 1:194837927-194837949 CAGATCCAAGCCATATCACAAGG - Intergenic
919628397 1:199935322-199935344 CAGATTCTTGCCCTGTCGCCAGG + Intergenic
919985152 1:202668736-202668758 CAAATCCCAGCTCTGTCCCTTGG - Intronic
920075801 1:203335515-203335537 CAGTTCCAAGCCCTGTAGCAAGG - Intergenic
920312482 1:205056761-205056783 CCCACCCCAGCCCTGTCGAAGGG + Intronic
920505478 1:206512671-206512693 CAGCCCCCAGCCCAGTCCCAAGG + Intronic
921193086 1:212726858-212726880 CAGAGCCGAGCCCGGTCCCAGGG + Intronic
924384820 1:243490849-243490871 CAGAACCCAGCCCTGTGGGCAGG + Intronic
1066631701 10:37464889-37464911 TAGATTCCACCCCTGTCCCAGGG + Intergenic
1072722039 10:97787100-97787122 CAGCTCCCATCCCTTTCGCAAGG - Intergenic
1073052929 10:100680978-100681000 CAGATCCCAGCCCAAGCGCCGGG - Intergenic
1075850987 10:125586819-125586841 CAGATCCAAGCCATATCGCCTGG - Intronic
1075900860 10:126041829-126041851 CAGGCCCCAGCCCTGCAGCAAGG - Intronic
1076480775 10:130783977-130783999 CAGACCGCAGCCCTGGCGAAGGG - Intergenic
1076980975 11:204627-204649 AAGATCCCAGCCCAGTGGCTAGG + Exonic
1077338383 11:2015479-2015501 GAGATCCCAGCCCTGCGGGAGGG - Intergenic
1077506197 11:2930979-2931001 AGGATCCCAGCCCTGCTGCAAGG - Intergenic
1080700543 11:34640412-34640434 CAGAGCCCAGCCCATTTGCATGG - Intronic
1081622693 11:44628295-44628317 CAGAGCCCACCCCTGACCCAGGG + Intergenic
1081669969 11:44937370-44937392 AAGATCACAGCCCTGCCCCAGGG + Intronic
1083379516 11:62253914-62253936 CAGACCACAACCCTGTCTCAGGG + Intergenic
1083697717 11:64453764-64453786 CAGCTCACTGCCCTGTGGCAAGG + Intergenic
1084169928 11:67396187-67396209 CAGAGCCCTTCCCTGTCCCAAGG - Intronic
1084974475 11:72789304-72789326 CAGATGCCAGACCTGGCGGAAGG - Intronic
1087153982 11:94883307-94883329 CAGATCTCAGCCCTGATGTAAGG - Intergenic
1088948930 11:114545712-114545734 CAGATTCCTGCCCTGTCTCCAGG + Intronic
1089161054 11:116437685-116437707 CAGTTTCCAGCCCTGCCACATGG - Intergenic
1090646879 11:128773453-128773475 CAGATAGCAGCCCTGTCAAATGG - Intronic
1202821367 11_KI270721v1_random:70661-70683 GAGATCCCAGCCCTGCGGGAGGG - Intergenic
1091759601 12:3077845-3077867 CATATCCCAGCCCTGCCCGAAGG - Intronic
1096613104 12:52816009-52816031 GAGATCCCACCCCAGACGCAGGG + Intergenic
1096827647 12:54292187-54292209 CAGATTCCAGCCCTCCCTCAAGG + Exonic
1100164580 12:91901671-91901693 CAGGTCCCAATCCTGACGCATGG - Intergenic
1102590082 12:113950351-113950373 CAGACCCCAGCCCGGTGTCATGG + Intronic
1103903527 12:124315697-124315719 CAGAAGCCAGCACTGTGGCAGGG + Exonic
1103984544 12:124758596-124758618 CTGATCCCAGCCCTGGCCGAAGG + Intergenic
1104381079 12:128308581-128308603 CAGAGTGCAGCCCTGTCCCAAGG - Intronic
1105900305 13:24746950-24746972 CAGAGCCCAGGCCTGGCGGATGG - Intergenic
1111091624 13:83453674-83453696 CAGGTCACAGCCCTGGCTCAGGG - Intergenic
1112028689 13:95437556-95437578 CAGATCCAGCCCCTGTCCCAAGG - Intronic
1113614729 13:111672048-111672070 CAGGTCCCAGCCCAGCTGCAAGG + Intronic
1113620198 13:111756962-111756984 CAGGTCCCAGCCCAGCTGCAAGG + Intergenic
1113910238 13:113838270-113838292 CACAGCCCAGCCCTGGAGCAGGG + Intronic
1113910258 13:113838348-113838370 CACAGCCCAGCCCTGGAGCAGGG + Intronic
1113910287 13:113838428-113838450 CACAGCCCAGCCCTGGAGCAGGG + Intronic
1113910319 13:113838509-113838531 CACAGCCCAGCCCTGGAGCAGGG + Intronic
1113910351 13:113838590-113838612 CACAGCCCAGCCCTGGAGCAGGG + Intronic
1113910382 13:113838671-113838693 CACAGCCCAGCCCTGGAGCAGGG + Intronic
1113910420 13:113838792-113838814 CACAGCCCAGCCCTGGAGCAGGG + Intronic
1114064323 14:19048125-19048147 CAGATCACAGCCCTCTGTCATGG - Intergenic
1114097936 14:19351873-19351895 CAGATCACAGCCCTCTGTCATGG + Intergenic
1115779683 14:36755852-36755874 CAGATGCCAGGCCTGTTACATGG - Intronic
1117207043 14:53453695-53453717 CAGATCCCTCCCCTGACACATGG - Intergenic
1118456404 14:65948813-65948835 CAGACTCCAGCCCTGAGGCAGGG + Intergenic
1118727725 14:68641212-68641234 CATATGCCAGCCCTGTCCTACGG + Intronic
1119740183 14:77008982-77009004 CAAATCCCAGCTCTGGCCCAGGG - Intergenic
1119821573 14:77620771-77620793 GAGATTCCAGCACTGTCACATGG - Intergenic
1121505742 14:94475137-94475159 CATGTCCCAGCCCTGTGGCAAGG + Intronic
1122362433 14:101175339-101175361 CAGAACCCAGCCCTTGCCCAGGG + Intergenic
1122507314 14:102239840-102239862 CAGAGTCCTGCCCTGTCGCCAGG - Intronic
1122663135 14:103311222-103311244 CAGAGCCCAGCCCAGAGGCACGG + Intergenic
1125969121 15:43897792-43897814 CAGGTCCCTCCCCTGTCACATGG - Intronic
1126666294 15:51078564-51078586 GAGATGCCACCCCTGTCCCATGG + Intronic
1132826956 16:1909925-1909947 CTGATCCCAGCCCTATCCCCAGG + Intergenic
1133130404 16:3673111-3673133 CTGATCCCTGACCTGTAGCAAGG - Intronic
1133328390 16:4956338-4956360 AAGTTCCCATCCCTGTCGCAAGG - Intronic
1134055584 16:11167821-11167843 CAGATGCCACCCCTGTTGCCAGG + Intronic
1135795798 16:25441491-25441513 CTGATCCCATCCCTGTGGGATGG - Intergenic
1135975718 16:27108079-27108101 CAGATCTAAGCCCTGTCCCTGGG + Intergenic
1137009864 16:35311442-35311464 CAGTGCCCAGCACTGTAGCAGGG + Intergenic
1137396973 16:48123051-48123073 CTGATCCCACCACTGTCTCATGG + Intronic
1137945719 16:52731642-52731664 CAGGTCCGAGCCCTGCCCCATGG - Intergenic
1137977188 16:53041913-53041935 CAAAGCCCTGCCCTGTCCCAGGG - Intergenic
1140833224 16:78770460-78770482 CAGATCCCAGTCCTGGCCCGTGG - Intronic
1141747094 16:85933112-85933134 CAGATGCCAGCTCTGCAGCACGG - Intergenic
1143554080 17:7650219-7650241 GAGATCCCAGCCCTGCAGCCAGG - Intronic
1146653131 17:34619414-34619436 CAGATACCAGGCCTGTCCCCTGG + Intronic
1147455744 17:40537001-40537023 GAGATGCCAGCTCTGTCGCCGGG - Intergenic
1147678109 17:42221072-42221094 CTGACCCCAGCCCTGACCCATGG + Intronic
1147687840 17:42297866-42297888 CTGACCCCAGCCCTGACCCATGG - Intronic
1149651371 17:58278550-58278572 CCACTCCCAGCCCTGTCCCACGG + Intronic
1149776763 17:59364325-59364347 CAGATGCCAGCCCTCTCCCAGGG - Intronic
1150249202 17:63696938-63696960 CAGCTCCCTGCCCTGTTCCACGG + Exonic
1152757096 17:82091599-82091621 GAGATCCCAGCGCTGTTGGATGG - Exonic
1156370447 18:36467781-36467803 CAGAGCCCATCTCTGTGGCAGGG - Intronic
1157012154 18:43662832-43662854 CAGATCACTGCCCTGCCTCATGG - Intergenic
1157691332 18:49684492-49684514 CAGCTCTCAGCCCTGTCCCCTGG - Intergenic
1157806954 18:50665373-50665395 CAGCCCCCAGCTCTGTTGCAGGG - Intronic
1161516628 19:4700083-4700105 CAGGCCCCAGCCCTGCCGCCCGG - Intronic
1161621280 19:5298642-5298664 CACATCACAGCCCTGGCGCCGGG + Intronic
1163313998 19:16530595-16530617 CAGAGCCCAGCCCTGGGGCTTGG - Exonic
1163777634 19:19227455-19227477 CAGCTCCCAGCCCTGCCCCCTGG + Exonic
1164783253 19:30910252-30910274 CAGCTCCCCGACCTGTAGCATGG + Intergenic
1165024317 19:32948625-32948647 CACATCCCAGCCATGTTGCCAGG + Intronic
1165878230 19:39024864-39024886 CTGGTCCCAGCCCTGTAGCTCGG + Exonic
1165907285 19:39201904-39201926 CAGATCCTAGCCCTAGTGCAGGG + Intergenic
1166299584 19:41906400-41906422 CAGATCCCAGCCCAGCCCCCTGG + Intronic
1167375042 19:49106590-49106612 CAGAACTCAGCCCTGCCTCACGG + Intronic
1167896341 19:52585353-52585375 CAGACCCCACCCCTGTCCGAAGG + Exonic
1167960768 19:53102934-53102956 CACATCCCACCCCTGTCCTAAGG - Intronic
1167964512 19:53132444-53132466 CAGACCCCACCCCTGTCTGAAGG - Intronic
1167972611 19:53197880-53197902 CAGACCCCACCCCTGTCCTAAGG + Intergenic
926124852 2:10265695-10265717 CAGCTCCAAGTCCTGACGCATGG + Intergenic
927138741 2:20115554-20115576 CAGACCGCAGCCCTGCCCCAGGG + Intergenic
927623159 2:24683646-24683668 AAGGTCCCAGCCCTGCCCCAAGG - Intronic
927686548 2:25175114-25175136 CAGCTGCCATCCCTGTCTCATGG + Intergenic
928231618 2:29503707-29503729 CACATCCCAGCCATGTTGCCTGG - Intronic
929809101 2:45173658-45173680 CAGAGTCCAGCCCTGTCTCCAGG + Intergenic
934506564 2:94898890-94898912 CAGAGCCTTGCTCTGTCGCACGG - Intergenic
935040279 2:99419772-99419794 CAGATCCCTGCCCCTTCTCAGGG - Intronic
936167935 2:110140041-110140063 CAGCCCCCAGCCCTGCTGCAAGG + Intronic
942866742 2:180685564-180685586 CAGAAACCACCCCTGTCGGAGGG + Intergenic
948230511 2:236345643-236345665 CCCATCCCAGCTCTGTCGCGAGG - Intronic
1172093025 20:32446931-32446953 CAGATCCCAGTGCTGCCACAGGG - Exonic
1172122887 20:32609057-32609079 CAGAGCTCAGCCCTGTCTCGGGG - Intergenic
1172146598 20:32762276-32762298 CAGATCCCCGCCCGGGCGCGGGG - Intergenic
1174174200 20:48634806-48634828 CAGATGCCAACCCTGCCCCAGGG + Intronic
1174339895 20:49889062-49889084 CACACCCCAGCCCTGTCCCAGGG + Exonic
1174384093 20:50176461-50176483 CTGGTCCCGGCCCTGTCGCCGGG - Intergenic
1174584801 20:51600093-51600115 CAGATCCCAACGCTGTAGCTTGG + Exonic
1174783560 20:53412317-53412339 AAGGTCCCAGCCCTGGAGCAAGG + Intronic
1175264433 20:57694014-57694036 CACCTCCCAGCCCTGCAGCAGGG + Intronic
1177597813 21:23268005-23268027 CAGATCCCAGCCTATTTGCAGGG - Intergenic
1178229189 21:30761465-30761487 CAGTACCCAGCACTGTCGAAAGG - Intergenic
1178623835 21:34199331-34199353 CAGATTCCAGCCCAGGCGCCTGG + Intergenic
1178683554 21:34693794-34693816 CAGATCCAAACCCTGTCACAAGG - Intronic
1178794930 21:35735118-35735140 CAGATCCCATCCCTGTCCCCAGG - Intronic
1179272352 21:39861290-39861312 CAGATCCAAGCCCTGTGCCAAGG + Intergenic
1179532267 21:42027979-42028001 GAGACCCCAGACCTGGCGCATGG + Intergenic
1180482814 22:15770751-15770773 CAGATCACAGCCCTCTGTCATGG - Intergenic
1180600594 22:17012792-17012814 CCCATCCCAGCCCTGCCCCATGG + Intergenic
1181436897 22:22916421-22916443 CAGATGCCATCCCTCTCTCAAGG + Intergenic
1181509994 22:23384862-23384884 CTGAGCCCAGCCCTGTCCCCAGG - Intergenic
1182778194 22:32846637-32846659 CAAATCCCAGCCCTGGTGCTGGG - Intronic
1184662112 22:45970259-45970281 CAGACCCCAGCACTGGCCCAGGG + Intronic
1184934884 22:47714002-47714024 CAGGGGCCAGCCCTGTCCCAGGG + Intergenic
1185173013 22:49304429-49304451 CAGAGCCCAGCCCTGCCTCCCGG + Intergenic
949610716 3:5700768-5700790 CAAATCTCAGCCCTTTCTCAAGG - Intergenic
950505923 3:13394450-13394472 CAGATCCCAGCCATGTGGGGAGG + Intronic
952455609 3:33468893-33468915 GAGATTCTAGCCCTGTCACATGG + Intergenic
954626807 3:52026302-52026324 CAGATCCCAGCCCTCTCCCAGGG + Intergenic
954691384 3:52397392-52397414 CACAACCCAGCCCTGGCTCATGG - Intronic
954993138 3:54858257-54858279 CAGACCCTAGCCCTATTGCAAGG + Intronic
955081867 3:55665269-55665291 CAGATCTCAGCCATTCCGCAAGG + Intronic
956748184 3:72326039-72326061 CAGATCCCAGCCCATACTCAAGG + Intergenic
962876258 3:139538195-139538217 CAAATCCCAGCTCTGGGGCAAGG + Intronic
964623426 3:158736971-158736993 CATATCCCACCCCTGGCCCAGGG + Intronic
965662939 3:171061158-171061180 CAGACCCCAGCCCTGACATAAGG - Intergenic
966192762 3:177286405-177286427 CACATCACTGCCCTGTAGCATGG - Intergenic
967202331 3:187083184-187083206 CAGACCAAAGCCCTGTCCCAAGG - Intergenic
967862431 3:194162079-194162101 GAGATCCCGGCTCTGTCCCATGG + Intergenic
969515787 4:7647578-7647600 CAGACCCCACCACTGTCACAAGG - Intronic
970482362 4:16489293-16489315 CAGATCACACCCCAGTCGAAGGG - Intergenic
970537282 4:17042353-17042375 CAGATCCCTCCCCTGACACATGG + Intergenic
970708414 4:18832854-18832876 CAGATCTCAGCCCTGTGGATGGG - Intergenic
978514639 4:109557639-109557661 CAGATCCGAGCCCTGCCCCATGG - Intergenic
979181656 4:117736172-117736194 CAGGTCCCAACCCTGACACACGG + Intergenic
981586765 4:146311734-146311756 CAGAGCCCAGCCCTGGGGAAAGG + Intronic
987052140 5:14156246-14156268 CTGATCCCAGCCCTGGGGCAAGG - Intronic
992285892 5:75235631-75235653 CACCTCCCAGCCCTGCCCCAAGG + Intronic
992894025 5:81231781-81231803 CAAATGCCATCCCTGTCACATGG - Intergenic
993529163 5:89003747-89003769 CAGGTCCCAGCCCTGCCCCGCGG + Intergenic
993675803 5:90814496-90814518 CAGATCCCACCCTTGACACATGG - Intronic
994149550 5:96432397-96432419 CAGATCCAAGTCCTGATGCAAGG - Intronic
996915511 5:128707540-128707562 CAGATCCCTTCCCTGACACATGG + Intronic
997749330 5:136329431-136329453 CATGCCCCAACCCTGTCGCAAGG - Intronic
1002071013 5:176678999-176679021 CAGTCCCCAGTCCTGTCCCAGGG + Intergenic
1005716312 6:28552554-28552576 CTGATCCCTGCCCTATCCCACGG + Intergenic
1006787234 6:36676621-36676643 CAGATCCCAGCCCTGTCGCAAGG - Intronic
1006918139 6:37609296-37609318 CAGAGCTCAGCCCTGTGGCTGGG + Intergenic
1006981727 6:38153158-38153180 CAGATCCCTGCACTGGCGAATGG - Exonic
1007775215 6:44221263-44221285 CTAGTCCCAGCCCTGTCACAAGG + Intronic
1007933227 6:45710914-45710936 CATATCCCTGCCCTGTAGCCAGG + Intergenic
1010564452 6:77392215-77392237 AAGATCCAAGCCCTTTGGCAGGG + Intergenic
1011931836 6:92723736-92723758 CAGGTCCCAGCCCTACCCCATGG - Intergenic
1013636980 6:112038348-112038370 CAGATCCCAGGCATGACGCCTGG + Intergenic
1013658784 6:112273215-112273237 CAGAGTCCAGCTCTGTCGCCAGG + Intergenic
1014096929 6:117471152-117471174 CTGATCCCAGCCCAGCCACATGG + Intronic
1014099392 6:117493750-117493772 CTGATCCCAGCCCAGCCACATGG + Intronic
1016984431 6:149884584-149884606 CAGATCCCACCTCTCTCTCAGGG + Intronic
1019167864 6:170110802-170110824 CCGATCCCAGCCTTGTCGGGCGG + Intergenic
1019457971 7:1140933-1140955 CTGATCCCAGGGCTGTGGCAGGG + Intergenic
1023806538 7:43876812-43876834 CACATCCCAGGCCTGTGGCACGG - Exonic
1023940805 7:44767422-44767444 CACATCCCGGCCCTGTCTCCAGG - Intronic
1025671693 7:63619624-63619646 CAGTACCCAGCCCTGTCACGAGG + Intergenic
1029257325 7:99278356-99278378 CAGAGCCCAGCCCTGACTCCAGG - Intergenic
1029379421 7:100203208-100203230 CAGATTCTAGCTCTGTCGCCAGG + Intronic
1029557813 7:101282466-101282488 CAGATTCTCGCCCTGTCGCCAGG - Intergenic
1029855744 7:103515222-103515244 CAGATGCCGGCCCTGTCGGGAGG - Exonic
1031219468 7:118946059-118946081 TAGACCCCTGCCTTGTCGCAAGG - Intergenic
1032007337 7:128313620-128313642 CAGATCCAAACCATGTCACAGGG - Intronic
1032332306 7:130991955-130991977 CAGAGCCCAGCTCTGTGGCTCGG - Intergenic
1033338057 7:140470020-140470042 CAGAGCCTAGCTCTGTCGCCAGG - Intronic
1034954152 7:155323255-155323277 CAGAGCCCAGCCATATCACAAGG - Intergenic
1035049897 7:155992631-155992653 CAGGCCCCAGCCCTGTGTCAGGG - Intergenic
1035398546 7:158550456-158550478 CAGACCTCAGCCCTGTCTTAGGG - Intronic
1038809810 8:30828686-30828708 CAGATCCAGACCCTGTCTCAGGG + Intergenic
1039086289 8:33783465-33783487 CAGACCCCTGCCTTATCGCAAGG + Intergenic
1040608896 8:48962947-48962969 CAGGTCCCACACCTGTCCCATGG - Intergenic
1040766376 8:50916196-50916218 TCGTTCTCAGCCCTGTCGCAAGG - Intergenic
1042937367 8:74073470-74073492 CAGAGCACAGCCATGTAGCAGGG + Intergenic
1046536030 8:115511590-115511612 CAGGTCCCAACTCTGTCACAGGG - Intronic
1048965503 8:139611695-139611717 CAGCTTCCAGCCCTGTTGTATGG + Intronic
1049282875 8:141759467-141759489 CAGACCCCAGCCCCATCCCAAGG + Intergenic
1049348819 8:142153224-142153246 CAGAACCCAGCCCTGGGGCATGG + Intergenic
1049556774 8:143286427-143286449 GGGAACCCAGCCTTGTCGCACGG - Intergenic
1051312192 9:15788208-15788230 CAAATCCCAGCTCTGTTGCTTGG + Intronic
1053306196 9:36986293-36986315 CAGGTCCCAGCGCTGGCGCGTGG - Intronic
1053367158 9:37531014-37531036 CAAATCCCAGCTCTGTCACTAGG + Intronic
1056788321 9:89608818-89608840 CAGAGACAAGCCCTGTCCCAAGG - Intergenic
1059352795 9:113677413-113677435 CAGACCCCAGACCTGCTGCATGG + Intergenic
1060194675 9:121616083-121616105 GAGAACCCAGCCCTGTCCCTGGG + Intronic
1061747474 9:132750886-132750908 CAGAGGCCAGCCCTGTGGCTTGG + Intronic
1061900857 9:133671300-133671322 CAGATCCCAACACTGTCCCTGGG + Intronic
1062032909 9:134370099-134370121 CAGATCCCAGCTGGGTCCCAGGG - Intronic
1062324695 9:136006368-136006390 CAGATCCCTGCCCTGTTGTGTGG + Intergenic
1062466661 9:136684619-136684641 CAGAGCTCAGGCCTGCCGCAGGG + Intronic
1062521296 9:136959051-136959073 CAGCTCCCAGCCCCGTCCCCTGG - Intergenic
1186302329 X:8213577-8213599 TAGATCACAACCCTGTCACACGG + Intergenic
1189291025 X:39886266-39886288 CAGATACCAGCCCTTTCTCTAGG + Intergenic
1190559231 X:51671010-51671032 CAGAGCCCTGCCCTGTGGCTTGG + Intergenic
1190565060 X:51722311-51722333 CAGAGCCCTGCCCTGTGGCTTGG - Intergenic
1190569597 X:51768174-51768196 CAGAGCCCTGCCCTGTGGCTTGG + Intergenic
1190889865 X:54558590-54558612 CAGAGCCTGGCCCTGTTGCAGGG - Exonic
1191858644 X:65648013-65648035 CTGGTCCCAGCCCAGTCGAATGG - Intronic
1193911151 X:87308751-87308773 CAGGTCCCAGCCCTGACACATGG + Intergenic
1195100631 X:101551391-101551413 CTGACACCAGCCCTGTCGCTTGG - Intronic
1197730595 X:129806045-129806067 CAGATCCCAGCCCTCCTGCTTGG - Exonic
1198873227 X:141197324-141197346 CAGGCCACAGCCCTGTCTCAGGG - Intergenic