ID: 1006787329

View in Genome Browser
Species Human (GRCh38)
Location 6:36677320-36677342
Sequence CTGCGTTAGAGGAAGAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006787324_1006787329 -8 Left 1006787324 6:36677305-36677327 CCTCCCCGAGGTCAGCTGCGTTA 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1006787329 6:36677320-36677342 CTGCGTTAGAGGAAGAAGACTGG No data
1006787320_1006787329 19 Left 1006787320 6:36677278-36677300 CCCACAGCAGAGGAGAAAGAAGC 0: 1
1: 0
2: 3
3: 39
4: 410
Right 1006787329 6:36677320-36677342 CTGCGTTAGAGGAAGAAGACTGG No data
1006787318_1006787329 24 Left 1006787318 6:36677273-36677295 CCATCCCCACAGCAGAGGAGAAA 0: 1
1: 0
2: 4
3: 34
4: 375
Right 1006787329 6:36677320-36677342 CTGCGTTAGAGGAAGAAGACTGG No data
1006787317_1006787329 25 Left 1006787317 6:36677272-36677294 CCCATCCCCACAGCAGAGGAGAA 0: 1
1: 1
2: 0
3: 23
4: 274
Right 1006787329 6:36677320-36677342 CTGCGTTAGAGGAAGAAGACTGG No data
1006787319_1006787329 20 Left 1006787319 6:36677277-36677299 CCCCACAGCAGAGGAGAAAGAAG 0: 1
1: 0
2: 4
3: 59
4: 525
Right 1006787329 6:36677320-36677342 CTGCGTTAGAGGAAGAAGACTGG No data
1006787323_1006787329 -3 Left 1006787323 6:36677300-36677322 CCTGTCCTCCCCGAGGTCAGCTG 0: 1
1: 0
2: 2
3: 23
4: 189
Right 1006787329 6:36677320-36677342 CTGCGTTAGAGGAAGAAGACTGG No data
1006787321_1006787329 18 Left 1006787321 6:36677279-36677301 CCACAGCAGAGGAGAAAGAAGCC 0: 1
1: 0
2: 5
3: 36
4: 383
Right 1006787329 6:36677320-36677342 CTGCGTTAGAGGAAGAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006787329 Original CRISPR CTGCGTTAGAGGAAGAAGAC TGG Intronic
No off target data available for this crispr