ID: 1006787627

View in Genome Browser
Species Human (GRCh38)
Location 6:36679084-36679106
Sequence CGCCCCAGCTGGGTTTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 200}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006787627_1006787637 -6 Left 1006787627 6:36679084-36679106 CCCCTGGAAACCCAGCTGGGGCG 0: 1
1: 0
2: 0
3: 17
4: 200
Right 1006787637 6:36679101-36679123 GGGGCGAGGGAGGGCGTGGACGG 0: 1
1: 0
2: 13
3: 125
4: 1368
1006787627_1006787644 29 Left 1006787627 6:36679084-36679106 CCCCTGGAAACCCAGCTGGGGCG 0: 1
1: 0
2: 0
3: 17
4: 200
Right 1006787644 6:36679136-36679158 AGCTCGCCTTTGGCTGCGGTTGG 0: 1
1: 0
2: 1
3: 1
4: 91
1006787627_1006787639 5 Left 1006787627 6:36679084-36679106 CCCCTGGAAACCCAGCTGGGGCG 0: 1
1: 0
2: 0
3: 17
4: 200
Right 1006787639 6:36679112-36679134 GGGCGTGGACGGGACCGTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 38
1006787627_1006787638 -5 Left 1006787627 6:36679084-36679106 CCCCTGGAAACCCAGCTGGGGCG 0: 1
1: 0
2: 0
3: 17
4: 200
Right 1006787638 6:36679102-36679124 GGGCGAGGGAGGGCGTGGACGGG 0: 1
1: 0
2: 0
3: 44
4: 559
1006787627_1006787640 6 Left 1006787627 6:36679084-36679106 CCCCTGGAAACCCAGCTGGGGCG 0: 1
1: 0
2: 0
3: 17
4: 200
Right 1006787640 6:36679113-36679135 GGCGTGGACGGGACCGTTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1006787627_1006787643 25 Left 1006787627 6:36679084-36679106 CCCCTGGAAACCCAGCTGGGGCG 0: 1
1: 0
2: 0
3: 17
4: 200
Right 1006787643 6:36679132-36679154 TGGGAGCTCGCCTTTGGCTGCGG 0: 1
1: 0
2: 0
3: 5
4: 148
1006787627_1006787636 -10 Left 1006787627 6:36679084-36679106 CCCCTGGAAACCCAGCTGGGGCG 0: 1
1: 0
2: 0
3: 17
4: 200
Right 1006787636 6:36679097-36679119 AGCTGGGGCGAGGGAGGGCGTGG 0: 1
1: 0
2: 5
3: 92
4: 1105
1006787627_1006787642 19 Left 1006787627 6:36679084-36679106 CCCCTGGAAACCCAGCTGGGGCG 0: 1
1: 0
2: 0
3: 17
4: 200
Right 1006787642 6:36679126-36679148 CCGTTCTGGGAGCTCGCCTTTGG 0: 1
1: 0
2: 0
3: 3
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006787627 Original CRISPR CGCCCCAGCTGGGTTTCCAG GGG (reversed) Intronic
900088800 1:910339-910361 GGCCCCAGCGGGGTCTCCCGGGG + Intergenic
900527429 1:3136046-3136068 CGCCCCAGCCTGGTGTCCTGTGG - Intronic
900560306 1:3301899-3301921 CGCGCCAGATGGATTTCCACGGG - Intronic
900609780 1:3539629-3539651 GGCCCCAGCTTGGTTTCCCAGGG - Intronic
901493268 1:9607433-9607455 GGCCTCAGCTGGGGTCCCAGAGG - Intronic
902618818 1:17638722-17638744 TGCCTCTGCTGGGCTTCCAGTGG + Intronic
904364084 1:29999570-29999592 CTCCACAGCTGGGGTCCCAGGGG - Intergenic
905359685 1:37410750-37410772 CTCTCCAGCTCTGTTTCCAGAGG - Intergenic
905808489 1:40894295-40894317 AGCCACAGCTGGATCTCCAGTGG + Intergenic
906154842 1:43607884-43607906 AGGCCCAGCTGCGTTTGCAGTGG - Intronic
906318888 1:44804721-44804743 AGCCTCAGCTGGGTATCCTGCGG + Exonic
906615234 1:47229181-47229203 TGCCCCAGGTGAGTTTTCAGGGG - Exonic
906769388 1:48471180-48471202 TGCCCCAGCTGGACTTCCACAGG + Intronic
911310797 1:96289631-96289653 CCCTCTTGCTGGGTTTCCAGAGG + Intergenic
912834791 1:112986526-112986548 TGCCCCAGCTGTGGTTCAAGTGG - Intergenic
913155311 1:116091788-116091810 AGCCCCAGCTGTGTCTGCAGTGG + Intergenic
915053426 1:153102704-153102726 TCCCCCTGCTGGGATTCCAGAGG - Intronic
915083378 1:153367266-153367288 TGCCCAAGCTGAGTTTTCAGAGG + Intergenic
915930799 1:160059732-160059754 AGCCCCTGTGGGGTTTCCAGCGG - Intronic
917229312 1:172818966-172818988 CTCCCCAGCTGAGGTTTCAGAGG - Intergenic
921404687 1:214765571-214765593 TCCTCCTGCTGGGTTTCCAGAGG + Intergenic
1063313980 10:4983979-4984001 AGCCCCAGCTGTGTCTACAGTGG + Intronic
1065158284 10:22893532-22893554 AGCCCCAGCTGTGTCTGCAGTGG + Intergenic
1065571346 10:27073279-27073301 AGCCCCAGCTGTGTCTGCAGTGG - Intronic
1067033693 10:42898126-42898148 CGCCCCCGCTGGGTCGCTAGAGG - Intergenic
1067269458 10:44776935-44776957 TGCCTCAGCTGGGATTGCAGGGG + Intergenic
1070412096 10:76151041-76151063 TGACCCAGCTGGGTGTTCAGAGG - Intronic
1070548813 10:77474582-77474604 CGCCCCATGTGAGTTTCCTGAGG - Intronic
1070718303 10:78738677-78738699 GGACCCAGCTGGGATTCCACTGG + Intergenic
1073552679 10:104417763-104417785 AGCCTCATCTGGGCTTCCAGTGG - Intronic
1076173461 10:128342870-128342892 CGTGATAGCTGGGTTTCCAGAGG - Intergenic
1076341766 10:129754270-129754292 AGCCCCAGCTGTCTGTCCAGGGG - Intronic
1076538578 10:131198952-131198974 CGCCCCAGCTGTGGCTCAAGTGG - Intronic
1076726894 10:132418139-132418161 CCTCCCTGCTGGCTTTCCAGTGG + Intergenic
1077251676 11:1563523-1563545 GGCTCCAACTGAGTTTCCAGAGG + Intronic
1078144372 11:8712960-8712982 TGCCCCAGCTCAGTCTCCAGAGG - Intronic
1078183347 11:9030601-9030623 CGCCCCAGCAGGATGTGCAGGGG - Intronic
1078687725 11:13548844-13548866 AGCCCCAGCTGTGTCTGCAGTGG + Intergenic
1081734403 11:45393094-45393116 GCCCCCAGCTGGGTTTCTGGAGG + Intergenic
1087691106 11:101321274-101321296 CACCCCAGCTGGTATTTCAGTGG + Intergenic
1088414031 11:109569240-109569262 CGCCCCAGCTGTATTTGCAGTGG + Intergenic
1092217985 12:6695644-6695666 GGTCCCAGCTGGGGTACCAGAGG + Exonic
1096263144 12:50105186-50105208 CTTCCCAGCTGGGGTTCCTGAGG + Intronic
1096617781 12:52843995-52844017 CTCTCCAGTTGGGTTGCCAGTGG - Intronic
1102255104 12:111410532-111410554 CGCCCCAGCTAGGTTTCAGGAGG - Intronic
1104633498 12:130424258-130424280 CGCCCCAGCCGTGCTTCCTGGGG + Intronic
1105504914 13:21001616-21001638 AGCCCCAGCTGAGTTCCCAGTGG + Intronic
1107885877 13:44873790-44873812 CTCTCCTGCTGGGGTTCCAGGGG - Intergenic
1110253894 13:73410240-73410262 CACCCCAGCTGTGTCACCAGAGG + Intergenic
1111164833 13:84446090-84446112 AGCCCCAGCTATGTTTTCAGTGG + Intergenic
1112068866 13:95825650-95825672 AGCCCCAGCTGTGTCTGCAGTGG + Intronic
1113450099 13:110402954-110402976 TGCCCCAGCTGTGGCTCCAGTGG - Intronic
1113636345 13:111921475-111921497 CGCCCCACCTGGCTCTCCACTGG - Intergenic
1116186626 14:41607042-41607064 CGCCCCAGCGCGGTGGCCAGCGG + Intergenic
1116336584 14:43665435-43665457 TCCCCCTGCTGGGATTCCAGAGG - Intergenic
1117073410 14:52076479-52076501 GGCCACCGCTGAGTTTCCAGAGG + Intergenic
1117372173 14:55088650-55088672 AGCCCTACCTGAGTTTCCAGAGG - Intergenic
1118365742 14:65094227-65094249 TTCCCCAGATGGGTGTCCAGGGG + Intronic
1118461350 14:65990083-65990105 CTTCCCAGCTGTGCTTCCAGTGG + Intronic
1118540020 14:66813531-66813553 CCCTCCTGCTGGGGTTCCAGAGG - Intronic
1121221365 14:92288134-92288156 CGCCCCAGCCCGGCTTCCAGGGG - Intergenic
1122246947 14:100410091-100410113 AACCCCATCTGAGTTTCCAGAGG + Intronic
1122776356 14:104118568-104118590 CCCCCCACCTGGGTGGCCAGGGG - Intergenic
1126570128 15:50141817-50141839 CACACTAGCTGGGTTTCCAGTGG + Intronic
1128249865 15:66156485-66156507 AGCCACAGCTGGGGATCCAGTGG + Intronic
1128458951 15:67851648-67851670 CGCCCAAGCTGGGAGTGCAGTGG + Intergenic
1129607078 15:77030206-77030228 CGCCCCACCTCACTTTCCAGAGG - Intronic
1130605014 15:85307790-85307812 AGCCCCAGCTGTGTTTGCAGTGG - Intergenic
1131061709 15:89408544-89408566 CGGCCCATCCGGGTTCCCAGAGG - Intergenic
1133419905 16:5637355-5637377 CTCCAGAGCTAGGTTTCCAGGGG + Intergenic
1134103808 16:11471115-11471137 CGATCCAGCTGGGATTTCAGAGG + Intronic
1134465259 16:14470582-14470604 CGCCACAGCTGGGACTACAGGGG + Intronic
1138594613 16:58023192-58023214 CACCCCAGCTTTGTTTCCAAGGG + Intergenic
1139234317 16:65318472-65318494 TTCCCCTGCTGGGCTTCCAGAGG - Intergenic
1139589193 16:67924011-67924033 GGCCTCAGCAGGGCTTCCAGAGG + Intronic
1141623715 16:85250405-85250427 CGCCCCAGCTGGGTGTTCCCAGG + Intergenic
1143272951 17:5689145-5689167 CCCCCCTGCTGGGTGCCCAGTGG + Intergenic
1143874301 17:9980157-9980179 CGCCTCAGCTGATTTTCTAGAGG + Intronic
1144756627 17:17683445-17683467 CCACACAGCTGGGTTTTCAGAGG + Intronic
1146037202 17:29417782-29417804 AGCCGTAACTGGGTTTCCAGTGG - Intronic
1146263322 17:31435667-31435689 CGACCCAGCTGGATTCCAAGAGG - Intronic
1146454432 17:32997957-32997979 CGCTTGGGCTGGGTTTCCAGTGG + Intergenic
1147784403 17:42968651-42968673 CACCCCAGCTTGGTTACTAGAGG + Exonic
1148256017 17:46132901-46132923 CGCCCAAGCTGGAAGTCCAGTGG - Intronic
1150280575 17:63927777-63927799 TGCCCCACCTGGAATTCCAGAGG + Intergenic
1150617903 17:66786162-66786184 CTTCCCAGCTGGGTGTCCACAGG - Intronic
1152104224 17:78319335-78319357 CGCCCCAACTGTGTATCCACAGG - Intergenic
1153532973 18:6068681-6068703 AGCCCCAGCTGTGTGTGCAGTGG + Intronic
1157493448 18:48139362-48139384 CGCTCCAGCTGGGTTTGAAAAGG - Intronic
1159955672 18:74516763-74516785 CCCCTCAGCTGGGATTCCTGGGG + Intronic
1161289065 19:3483169-3483191 GGCCCCAGCTGGGTTTCGGTGGG + Intergenic
1163793168 19:19320261-19320283 CGCCCCCGCTTGGTTTGCTGAGG - Intronic
1165756550 19:38296577-38296599 CGCCCAGGCTGGGGTGCCAGTGG - Intronic
1165777739 19:38414808-38414830 CGCCCAGGCTGGGCTTCCAAGGG - Intronic
1168354394 19:55692481-55692503 CACCCCAGCTGGGGTCCCAGGGG + Intronic
925262376 2:2539896-2539918 CACTCCAGCTGGTTTTCCTGGGG - Intergenic
926048373 2:9727017-9727039 GGCCCCAGCTCGGTTTCCCTTGG - Intergenic
934041183 2:88128942-88128964 TGGCCCAGCAGGGCTTCCAGTGG + Intergenic
934042157 2:88136602-88136624 CACCCAAGGTGGGCTTCCAGGGG - Intergenic
934045364 2:88169254-88169276 AGTCCCAGCTGGGCCTCCAGTGG - Intergenic
936634915 2:114244919-114244941 AGCCCCAGCTGCTTTCCCAGGGG + Intergenic
936900897 2:117481100-117481122 GGCCCCAGCTGTGTCTTCAGTGG + Intergenic
937057817 2:118954197-118954219 AGCCCCAAGTGTGTTTCCAGGGG - Intronic
937392159 2:121498331-121498353 CCCCCCAGCTGGGACTACAGGGG + Intronic
937802153 2:126092495-126092517 CACCCCAGCTGAGGCTCCAGTGG + Intergenic
938920524 2:135990392-135990414 CTCCCCATCTCCGTTTCCAGAGG + Intergenic
945521551 2:210833731-210833753 AGCCCCAGCTGTGTCTGCAGTGG + Intergenic
946739244 2:222785498-222785520 CTTCCCAGCTATGTTTCCAGAGG - Intergenic
946874214 2:224111543-224111565 AGCCCCAGCTGTGTCTTCAGTGG - Intergenic
947753444 2:232544615-232544637 CTCCCCAGCTGGGGTCCCAGGGG - Intronic
948757401 2:240167561-240167583 TGCCCCAGCTGTGTGGCCAGAGG + Intergenic
1169900822 20:10550361-10550383 CACGCCCACTGGGTTTCCAGAGG - Intronic
1172997039 20:39078544-39078566 CCTCCCTGCTGGGTTTCCTGTGG + Intergenic
1174622150 20:51883784-51883806 CGCCCAAGCTGGGGTTGCAGTGG - Intergenic
1176033071 20:63023203-63023225 GGACCCAGCTGGGTCTCCTGTGG - Intergenic
1176101628 20:63367052-63367074 CGCCACACCTGGGCTTCCTGGGG + Intronic
1177939447 21:27390557-27390579 GGCCACAGCTGGGTGTCCAGGGG - Intergenic
1178611453 21:34085639-34085661 CGCCCAAGCTGGAGTGCCAGTGG + Intronic
1179940430 21:44636225-44636247 CAACCCTGCCGGGTTTCCAGGGG + Intronic
1180192537 21:46172953-46172975 TCCCCCAGCTGGGGTTCCAGAGG - Intronic
1180945164 22:19688635-19688657 CCCCCGAGCAGGGTTTGCAGAGG + Intergenic
1181161954 22:20964893-20964915 CGCCCCAGCTGGGCATCCCTGGG + Intergenic
1181374870 22:22449361-22449383 CACCCAAGCTTGGTGTCCAGAGG + Intergenic
1181921842 22:26326868-26326890 GGCCCCAGAGGGGTTTGCAGGGG - Intronic
1182127266 22:27825182-27825204 TTCCCTAGCTGGCTTTCCAGAGG + Intergenic
1182755105 22:32673005-32673027 GGCCCCAGATGGGGTTCAAGTGG + Intronic
1184693622 22:46128324-46128346 CCCCCCAGCTGGGACCCCAGGGG + Intergenic
950226606 3:11240563-11240585 GGCCCCAGTGGGTTTTCCAGGGG - Intronic
952872232 3:37911206-37911228 AGCCCCAGATGGGATTACAGTGG + Intronic
954234345 3:49244797-49244819 GACCCCAGCCTGGTTTCCAGTGG + Intronic
954654418 3:52185364-52185386 CACCCCAGCTGAGCTTCAAGGGG + Intergenic
954749164 3:52804057-52804079 CACCCTACCTGGGTGTCCAGTGG + Intronic
955405438 3:58622874-58622896 CTCCACAGCTGGGTTCCCAAAGG - Intronic
956881104 3:73511421-73511443 CTCTAGAGCTGGGTTTCCAGGGG + Intronic
957677958 3:83394268-83394290 GGCCCCAGCTGTTTTTGCAGTGG - Intergenic
958151950 3:89702825-89702847 AGCCCCAGTTGTGTCTCCAGTGG - Intergenic
958768292 3:98396687-98396709 AGCCCCAGCTGTGTCTGCAGTGG - Intergenic
959241922 3:103808047-103808069 CCCTCCTGCTGGGGTTCCAGAGG - Intergenic
961649123 3:128408687-128408709 CTCCCCAGCTGTGTTCCAAGGGG + Intergenic
963766676 3:149343365-149343387 TGCCCCAGCTGGTTTCCCTGTGG - Intergenic
966553278 3:181229804-181229826 AGCCCCAGCTGTGTCTACAGTGG + Intergenic
967203334 3:187095153-187095175 AGCCCCAGCTGTGTCTGCAGTGG - Intergenic
969840692 4:9879532-9879554 CGCCCCTGCAGTCTTTCCAGAGG + Intronic
970998070 4:22290891-22290913 CACCTCAGCTGGGTTTCCAATGG + Intergenic
971061781 4:22979376-22979398 AGCCCCAGCTGTGTCTGCAGTGG - Intergenic
972830655 4:42810222-42810244 CCCTCCTGCTGGGGTTCCAGAGG + Intergenic
973339026 4:48985891-48985913 GTCCCCATCTGGGTCTCCAGCGG + Intergenic
974582012 4:63815086-63815108 CCCTCCTGCTGGGGTTCCAGAGG + Intergenic
976247334 4:83016982-83017004 CGCCCAAGCTGGGAGTGCAGTGG + Intergenic
981139662 4:141253853-141253875 AGCCCCAGCTGTGTCTGCAGTGG + Intergenic
982743939 4:159086827-159086849 CACACCAGCTGTTTTTCCAGAGG - Intergenic
985680347 5:1252793-1252815 GGCCCCAGCTGGGGTGGCAGGGG - Intergenic
985893312 5:2733264-2733286 CATCCCTGCTGGGATTCCAGTGG - Intergenic
986609651 5:9553593-9553615 TGCCCCAGCTGGGGCTCAAGTGG - Intergenic
989525891 5:42453775-42453797 AGCCCCAGCTGTGTCTGCAGTGG + Intronic
997058970 5:130478368-130478390 AGCCCCAGCTGTGTCTACAGTGG + Intergenic
997586878 5:135048610-135048632 CATCCCAGCTGGGGGTCCAGGGG - Intronic
998110519 5:139498817-139498839 CACCCCAGCTGGAGTTGCAGTGG + Intergenic
998413369 5:141928048-141928070 TGCCCCACCTGGATTTCCTGAGG + Intronic
999269522 5:150288716-150288738 GTCCCCAGCTGGGTTTCTGGAGG - Intronic
1001406524 5:171480999-171481021 CGCCCCACCTGGGGCTCCACTGG + Intergenic
1001823002 5:174724601-174724623 CGCCGCTGCCGGGTTGCCAGCGG + Exonic
1002166124 5:177347565-177347587 CTCCCCAGGTGGGTTTGCTGTGG - Intronic
1002336907 5:178485861-178485883 TGCCCCAGCTGAGTGGCCAGGGG + Intronic
1003076814 6:2989283-2989305 CGCCCCAGCCCGGTTTCCCGCGG - Intronic
1006512484 6:34529133-34529155 CGCCCCATCTGGGGACCCAGGGG - Intronic
1006787627 6:36679084-36679106 CGCCCCAGCTGGGTTTCCAGGGG - Intronic
1011601584 6:89065066-89065088 CGGGCCAGCTGGAGTTCCAGGGG + Intergenic
1011736170 6:90313022-90313044 CGCCCACCCTGGGTTCCCAGTGG - Intergenic
1014532041 6:122569982-122570004 AGCCCCAGCTGTGTCTTCAGTGG - Intronic
1017545542 6:155447544-155447566 AGCCCCAGATGGTTTTCAAGAGG + Intronic
1018431561 6:163726512-163726534 CACCCCAGCTGTCTCTCCAGTGG + Intergenic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1022843527 7:34188524-34188546 TGCCCCTGCAGGTTTTCCAGTGG - Intergenic
1023445267 7:40224962-40224984 AGCCCCAGCTGTGTCTGCAGTGG + Intronic
1026468035 7:70671268-70671290 CTCCCCAGCTGGGTATTCAGTGG + Intronic
1026983894 7:74542758-74542780 GTGCCCAGCTGGGTTTGCAGTGG + Intronic
1029610344 7:101623181-101623203 CATCCCAGCTGGGCTGCCAGAGG - Intronic
1032078353 7:128846629-128846651 CTCCTCAGCTGGGTCCCCAGCGG + Intronic
1037112640 8:15183045-15183067 TGCCCCTGAAGGGTTTCCAGTGG - Intronic
1039112175 8:34052123-34052145 AGCCCCAGCTGTGTCTGCAGTGG - Intergenic
1039198486 8:35059972-35059994 AGTCCCAGCTGTGTTTGCAGTGG + Intergenic
1041734510 8:61095498-61095520 CCGCTCAGCTGGGTTTCCATGGG - Intronic
1042904130 8:73756218-73756240 AGCCCCAGCTGCGGTCCCAGTGG - Intronic
1043052103 8:75396969-75396991 GGTTCCAGCTGGGTTTCCGGTGG + Intergenic
1043495680 8:80797562-80797584 CACCCCAGCTGTGATTCAAGTGG - Intronic
1046284707 8:112079817-112079839 AGCCCCAGCTGTGTCTGCAGTGG + Intergenic
1047022203 8:120786461-120786483 AGCCCCAGCTGTGTCTGCAGTGG - Intronic
1048162612 8:132034879-132034901 TGTCCCACCTGGGTTTCCAGAGG + Intronic
1048705253 8:137146553-137146575 CGGAGCAGCTTGGTTTCCAGAGG + Intergenic
1049962807 9:752793-752815 CATGCCACCTGGGTTTCCAGAGG - Intergenic
1050476316 9:6045085-6045107 AGCCCCAGCTGTGTCTGCAGTGG + Intergenic
1051893640 9:21967331-21967353 CCCCCAGGCTGGGGTTCCAGAGG - Exonic
1053364981 9:37516389-37516411 CGTCTCAGTTGGGTTGCCAGTGG - Intronic
1053536151 9:38928244-38928266 CACCCCAGCTGTGTTCCCAATGG + Intergenic
1054629984 9:67435708-67435730 CACCCCAGCTGTGTTCCCAATGG - Intergenic
1055600515 9:77912885-77912907 CACCACAGCTGGGATTACAGGGG - Intronic
1056530034 9:87478873-87478895 CGGTCCTGCTGGGCTTCCAGGGG - Intergenic
1059539827 9:115118854-115118876 CTTCTCAGCTGGGTCTCCAGGGG + Intergenic
1059665836 9:116445888-116445910 CCCCCCAGCAGGGTTGCCTGAGG - Intronic
1060217865 9:121749137-121749159 TGGCCCAGCTGGGATCCCAGGGG - Intronic
1060526562 9:124324279-124324301 GGCCACCTCTGGGTTTCCAGAGG + Intronic
1061275308 9:129566714-129566736 CTCCCCAGATGGGATTCTAGAGG - Intergenic
1061375190 9:130219923-130219945 CGTCCCAGCTGTGTCTGCAGAGG + Intronic
1061868415 9:133507220-133507242 TCCCCCAGCTGGTTTTCCAGTGG - Intergenic
1062357178 9:136170514-136170536 TGCCCCTGCTGGGTCTACAGAGG - Intergenic
1190052164 X:47158369-47158391 AGCTCCAGCTGGGTGGCCAGGGG - Intronic
1191609929 X:63101679-63101701 TCCCCCTGCTGGGATTCCAGGGG - Intergenic
1191866288 X:65706438-65706460 CACCCCTGCTGGGCTTTCAGTGG - Intronic
1193995820 X:88365135-88365157 AGCCCCAGCTGTGTCTACAGTGG - Intergenic
1196468079 X:115993261-115993283 TCCCTCAGCTGGGATTCCAGAGG - Intergenic
1197371265 X:125628527-125628549 AGCCCCAGCTGGGTCTGTAGTGG - Intergenic
1197393653 X:125898717-125898739 CCCTGCAGCTGGGATTCCAGAGG + Intergenic
1197493789 X:127152986-127153008 AGCCCCAGCTGTGTCTGCAGTGG + Intergenic
1198679423 X:139165675-139165697 TGCCCCAGCTGGATTTCAAGCGG + Intronic
1199086213 X:143633704-143633726 CGGGCCAGCGGGGTTTCCCGAGG - Intronic
1199673524 X:150165988-150166010 GGCACCAGCTGGGGTTCCAAGGG - Intergenic
1199973923 X:152880509-152880531 CGCCCAGGCTGGATTTACAGTGG - Intergenic