ID: 1006787944

View in Genome Browser
Species Human (GRCh38)
Location 6:36680284-36680306
Sequence GCGCGCGTGCGTGTCTGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006787931_1006787944 27 Left 1006787931 6:36680234-36680256 CCCGTGCTTTGGGCGTGGAGATA 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1006787944 6:36680284-36680306 GCGCGCGTGCGTGTCTGCGCGGG No data
1006787940_1006787944 -7 Left 1006787940 6:36680268-36680290 CCGGCTCCCGGCGCGCGCGCGCG 0: 1
1: 0
2: 3
3: 50
4: 326
Right 1006787944 6:36680284-36680306 GCGCGCGTGCGTGTCTGCGCGGG No data
1006787932_1006787944 26 Left 1006787932 6:36680235-36680257 CCGTGCTTTGGGCGTGGAGATAA 0: 1
1: 0
2: 2
3: 7
4: 65
Right 1006787944 6:36680284-36680306 GCGCGCGTGCGTGTCTGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006787944 Original CRISPR GCGCGCGTGCGTGTCTGCGC GGG Intronic
No off target data available for this crispr