ID: 1006788940

View in Genome Browser
Species Human (GRCh38)
Location 6:36686282-36686304
Sequence GATGATGCCCCCACTCGGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 81}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006788940_1006788949 19 Left 1006788940 6:36686282-36686304 CCTCACCGAGTGGGGGCATCATC 0: 1
1: 0
2: 0
3: 1
4: 81
Right 1006788949 6:36686324-36686346 CACCTCCTCTAAGGTTGGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 126
1006788940_1006788947 15 Left 1006788940 6:36686282-36686304 CCTCACCGAGTGGGGGCATCATC 0: 1
1: 0
2: 0
3: 1
4: 81
Right 1006788947 6:36686320-36686342 CCCTCACCTCCTCTAAGGTTGGG 0: 1
1: 0
2: 0
3: 14
4: 157
1006788940_1006788943 10 Left 1006788940 6:36686282-36686304 CCTCACCGAGTGGGGGCATCATC 0: 1
1: 0
2: 0
3: 1
4: 81
Right 1006788943 6:36686315-36686337 GAGTCCCCTCACCTCCTCTAAGG 0: 1
1: 0
2: 2
3: 18
4: 191
1006788940_1006788945 14 Left 1006788940 6:36686282-36686304 CCTCACCGAGTGGGGGCATCATC 0: 1
1: 0
2: 0
3: 1
4: 81
Right 1006788945 6:36686319-36686341 CCCCTCACCTCCTCTAAGGTTGG 0: 1
1: 0
2: 2
3: 10
4: 177
1006788940_1006788950 20 Left 1006788940 6:36686282-36686304 CCTCACCGAGTGGGGGCATCATC 0: 1
1: 0
2: 0
3: 1
4: 81
Right 1006788950 6:36686325-36686347 ACCTCCTCTAAGGTTGGGCAGGG 0: 1
1: 0
2: 1
3: 5
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006788940 Original CRISPR GATGATGCCCCCACTCGGTG AGG (reversed) Exonic
900989167 1:6090192-6090214 GAAGATCCCCCCACTCCCTGTGG + Intronic
912372757 1:109186539-109186561 GATGATGCCCCAAATACGTGGGG - Intronic
914919484 1:151837975-151837997 GCTGCTGCCCCCGCTGGGTGGGG - Exonic
915796341 1:158738348-158738370 GGTGATGCTCCCACTCTGTCTGG - Intergenic
921099139 1:211913044-211913066 GAACACGCCCTCACTCGGTGTGG - Intergenic
1066167377 10:32801840-32801862 GATGTTGCCACCACTTGGAGTGG + Intronic
1075784243 10:125038116-125038138 TATGATGTCCCCACCCCGTGTGG + Intronic
1076798976 10:132811968-132811990 GCTGATGGCCCCACTGTGTGGGG - Intronic
1092655848 12:10684719-10684741 GATGATGCCCACACACACTGAGG + Intergenic
1111440752 13:88280604-88280626 GATGTTGCCACCACTGGGGGTGG - Intergenic
1117041687 14:51774372-51774394 GATGAGGCCCCCCCGCGATGTGG - Intergenic
1118438826 14:65794535-65794557 GATGATGGGCCCACTCGAAGTGG - Intergenic
1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG + Intronic
1122485614 14:102077617-102077639 GATGATGGCACCACTTGGGGAGG - Intergenic
1122804616 14:104250226-104250248 GATGGTCCCCCCATTTGGTGTGG + Intergenic
1122804999 14:104252147-104252169 GAGGATGCTCCCACTCTGTTGGG + Intergenic
1124862669 15:33458248-33458270 GATGATGCCCCCTCACATTGGGG - Intronic
1125416193 15:39455578-39455600 GATCATACGCCCACTCAGTGGGG - Intergenic
1127606629 15:60592865-60592887 CTTTCTGCCCCCACTCGGTGGGG + Intronic
1132550137 16:550835-550857 GGTGATGGCCCCGGTCGGTGAGG + Intronic
1133052880 16:3127972-3127994 GATGATGCCCACCCGTGGTGAGG - Intergenic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1135570496 16:23545516-23545538 GGTTATTCCCCCACTCTGTGAGG + Intronic
1140839387 16:78825095-78825117 GAGGATGCCGGCACTCGGGGAGG + Intronic
1141624565 16:85254471-85254493 CATGACCCCCCCACTCGGAGAGG + Intergenic
1147402967 17:40191951-40191973 AAAGATGCCCCCACTGAGTGTGG - Intronic
1151475583 17:74342863-74342885 GATGATGCCCCGGCTCGGGTTGG - Intronic
1157555835 18:48612424-48612446 GGTGTTGCTCCCACTCTGTGGGG + Intronic
1161679038 19:5669842-5669864 GATGATGCCCACACTGTGGGTGG - Intergenic
926750829 2:16197380-16197402 GCTGATGCACCCACACAGTGAGG - Intergenic
933266048 2:80181308-80181330 GATGTTGCCACCACTGGGGGTGG + Intronic
935125630 2:100220044-100220066 GATGAGGCCCCCCCACAGTGGGG - Intergenic
938501230 2:131832129-131832151 CATGCAGCCCCCACTGGGTGTGG - Intergenic
945234492 2:207622115-207622137 GATGATGCCCACACTAAATGGGG + Intronic
946790582 2:223297152-223297174 GATGTTGCCACCACTGGGGGTGG - Intergenic
1172073298 20:32274842-32274864 GATGATGACTCCCCTCAGTGAGG - Intergenic
1177701171 21:24641239-24641261 GATGATTCACCCACTCCGAGTGG + Intergenic
1182618325 22:31603688-31603710 GAGGGTGCCCTCACTGGGTGGGG + Intronic
1182760391 22:32717875-32717897 GATGAGGCCGCCACGGGGTGAGG - Intronic
949517535 3:4821021-4821043 TAGGATGCCCCCGCTCAGTGGGG - Intronic
957634103 3:82759533-82759555 GATGTTGCCCCCACTGTGGGTGG - Intergenic
967807276 3:193727226-193727248 GATGTTGGCCCCACGAGGTGAGG + Intergenic
970477202 4:16435714-16435736 GATGATGCCCCCTCACATTGTGG + Intergenic
970979721 4:22082147-22082169 GATGATGCCCCAAATTGGGGAGG + Intergenic
975734047 4:77364609-77364631 GATGTTGCCACCACTTGGGGGGG + Intronic
979555941 4:122047705-122047727 CATAATGCCCCCACTCTCTGGGG + Intergenic
983143864 4:164188407-164188429 GATGCTGCTGCTACTCGGTGAGG + Intronic
985343242 4:188974797-188974819 AATGATGTCCCCACAGGGTGGGG + Intergenic
994316487 5:98339303-98339325 GCTGTAGCGCCCACTCGGTGAGG - Intergenic
999351045 5:150872280-150872302 GATGTTGCCCCCACTGGGGATGG - Intronic
1001747456 5:174102619-174102641 GATGGTGCCCCCACTTTGTTTGG + Intronic
1004548014 6:16617835-16617857 GATGATGTCTCCTCTCAGTGGGG + Intronic
1004648558 6:17586386-17586408 GATGATGCCCACACACATTGAGG - Intergenic
1006788940 6:36686282-36686304 GATGATGCCCCCACTCGGTGAGG - Exonic
1016690495 6:146932428-146932450 GAGGATGCTCCCAATCGGTGGGG - Intergenic
1018431569 6:163726559-163726581 GCTGATGCCCAGACTTGGTGTGG + Intergenic
1018671268 6:166179452-166179474 AATGATGCCCTCACACAGTGTGG - Intergenic
1019040455 6:169099834-169099856 GATGTTGCCACCACTGGGGGTGG - Intergenic
1020751711 7:12148934-12148956 GATGATGCCTCCCCACAGTGAGG + Intergenic
1042045599 8:64647757-64647779 GATGATGCCCTCCCGCAGTGGGG + Intronic
1043142125 8:76603381-76603403 GAAGAGCCCCTCACTCGGTGGGG - Intergenic
1045826506 8:106404152-106404174 GATGCTGCTACCACTGGGTGTGG + Intronic
1062338186 9:136081741-136081763 GCTGCTGCCGCCACTTGGTGGGG - Intronic
1062392028 9:136337679-136337701 GATGAGGCCAGGACTCGGTGGGG - Intronic
1062498427 9:136842389-136842411 GGTGCAGCCCCCACTGGGTGCGG + Intronic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185700091 X:2224206-2224228 TATGATGCCTCCACCCGGAGAGG + Intronic