ID: 1006790370

View in Genome Browser
Species Human (GRCh38)
Location 6:36697462-36697484
Sequence GCTAAGTGTATGGGATGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006790370_1006790379 23 Left 1006790370 6:36697462-36697484 CCGGGGCATCCCATACACTTAGC No data
Right 1006790379 6:36697508-36697530 ACCTGCTGCTGTCTGGGATAAGG No data
1006790370_1006790378 17 Left 1006790370 6:36697462-36697484 CCGGGGCATCCCATACACTTAGC No data
Right 1006790378 6:36697502-36697524 CCATCAACCTGCTGCTGTCTGGG No data
1006790370_1006790376 16 Left 1006790370 6:36697462-36697484 CCGGGGCATCCCATACACTTAGC No data
Right 1006790376 6:36697501-36697523 CCCATCAACCTGCTGCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006790370 Original CRISPR GCTAAGTGTATGGGATGCCC CGG (reversed) Intergenic