ID: 1006790371

View in Genome Browser
Species Human (GRCh38)
Location 6:36697471-36697493
Sequence GTGGCTGAAGCTAAGTGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006790371_1006790378 8 Left 1006790371 6:36697471-36697493 CCCATACACTTAGCTTCAGCCAC No data
Right 1006790378 6:36697502-36697524 CCATCAACCTGCTGCTGTCTGGG No data
1006790371_1006790381 25 Left 1006790371 6:36697471-36697493 CCCATACACTTAGCTTCAGCCAC No data
Right 1006790381 6:36697519-36697541 TCTGGGATAAGGCATTGCCTTGG No data
1006790371_1006790379 14 Left 1006790371 6:36697471-36697493 CCCATACACTTAGCTTCAGCCAC No data
Right 1006790379 6:36697508-36697530 ACCTGCTGCTGTCTGGGATAAGG No data
1006790371_1006790376 7 Left 1006790371 6:36697471-36697493 CCCATACACTTAGCTTCAGCCAC No data
Right 1006790376 6:36697501-36697523 CCCATCAACCTGCTGCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006790371 Original CRISPR GTGGCTGAAGCTAAGTGTAT GGG (reversed) Intergenic