ID: 1006790372

View in Genome Browser
Species Human (GRCh38)
Location 6:36697472-36697494
Sequence CGTGGCTGAAGCTAAGTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006790372_1006790379 13 Left 1006790372 6:36697472-36697494 CCATACACTTAGCTTCAGCCACG No data
Right 1006790379 6:36697508-36697530 ACCTGCTGCTGTCTGGGATAAGG No data
1006790372_1006790381 24 Left 1006790372 6:36697472-36697494 CCATACACTTAGCTTCAGCCACG No data
Right 1006790381 6:36697519-36697541 TCTGGGATAAGGCATTGCCTTGG No data
1006790372_1006790376 6 Left 1006790372 6:36697472-36697494 CCATACACTTAGCTTCAGCCACG No data
Right 1006790376 6:36697501-36697523 CCCATCAACCTGCTGCTGTCTGG No data
1006790372_1006790378 7 Left 1006790372 6:36697472-36697494 CCATACACTTAGCTTCAGCCACG No data
Right 1006790378 6:36697502-36697524 CCATCAACCTGCTGCTGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006790372 Original CRISPR CGTGGCTGAAGCTAAGTGTA TGG (reversed) Intergenic